Human LAIR1/CD305/LAIR-1 ORF/cDNA clone-Lentivirus particle (NM_002287)
Cat. No.: vGMLP003510
Pre-made Human LAIR1/CD305/LAIR-1 Lentiviral expression plasmid for LAIR1 lentivirus packaging, LAIR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
LAIR1/CD305 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003510 | Human LAIR1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003510 |
Gene Name | LAIR1 |
Accession Number | NM_002287 |
Gene ID | 3903 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 864 bp |
Gene Alias | CD305,LAIR-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGAAGATCTGCCCAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTGGGGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCTAGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAGGAAATGCCGGGCTTTATCGCTGCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAAGCTCTGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCCTGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGTGTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTGA |
ORF Protein Sequence | MSPHPTALLGLVLCLAQTIHTQEEDLPRPSISAEPGTVIPLGSHVTFVCRGPVGVQTFRLERDSRSTYNDTEDVSQASPSESEARFRIDSVREGNAGLYRCIYYKPPKWSEQSDYLELLVKESSGGPDSPDTEPGSSAGPTQRPSDNSHNEHAPASQGLKAEHLYILIGVSVVFLFCLLLLVLFCLHRQNQIKQGPPRSKDEEQKPQQRPDLAVDVLERTADKATVNGLPEKDRETDTSALAAGSSQEVTYAQLDHWALTQRTARAVSPQSTKPMAESITYAAVARH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T39047-Ab | Anti-LAIR1/ CD305/ LAIR-1 monoclonal antibody |
Target Antigen | GM-Tg-g-T39047-Ag | LAIR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003510 | Human LAIR1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003875 | Human LAIR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003510 | Human LAIR1 Lentivirus particle |
ORF Viral Vector | vGMLP003875 | Human LAIR1 Lentivirus particle |
Target information
Target ID | GM-T39047 |
Target Name | LAIR1 |
Gene ID | 3903, 574531, 101081847, 484308, 615295, 102149211 |
Gene Symbol and Synonyms | CD305,LAIR-1,LAIR1 |
Uniprot Accession | Q6GTX8 |
Uniprot Entry Name | LAIR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Pregnant state |
Gene Ensembl | ENSG00000167613 |
Target Classification | Not Available |
The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.