Human P2RY12/ADPG-R/ BDPLT8 ORF/cDNA clone-Lentivirus plasmid (NM_022788)
Pre-made Human P2RY12/ADPG-R/ BDPLT8 Lentiviral expression plasmid for P2RY12 lentivirus packaging, P2RY12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to P2RY12/ADPG-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003557 | Human P2RY12 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003557 |
Gene Name | P2RY12 |
Accession Number | NM_022788 |
Gene ID | 64805 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1029 bp |
Gene Alias | ADPG-R, BDPLT8, HORK3, P2T(AC), P2Y(12)R, P2Y(AC), P2Y(ADP), P2Y(cyc), P2Y12, SP1999 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAAGCCGTCGACAACCTCACCTCTGCGCCTGGTAACACCAGTCTGTGCACCAGAGACTACAAAATCACCCAGGTCCTCTTCCCACTGCTCTACACTGTCCTGTTTTTTGTTGGACTTATCACAAATGGCCTGGCGATGAGGATTTTCTTTCAAATCCGGAGTAAATCAAACTTTATTATTTTTCTTAAGAACACAGTCATTTCTGATCTTCTCATGATTCTGACTTTTCCATTCAAAATTCTTAGTGATGCCAAACTGGGAACAGGACCACTGAGAACTTTTGTGTGTCAAGTTACCTCCGTCATATTTTATTTCACAATGTATATCAGTATTTCATTCCTGGGACTGATAACTATCGATCGCTACCAGAAGACCACCAGGCCATTTAAAACATCCAACCCCAAAAATCTCTTGGGGGCTAAGATTCTCTCTGTTGTCATCTGGGCATTCATGTTCTTACTCTCTTTGCCTAACATGATTCTGACCAACAGGCAGCCGAGAGACAAGAATGTGAAGAAATGCTCTTTCCTTAAATCAGAGTTCGGTCTAGTCTGGCATGAAATAGTAAATTACATCTGTCAAGTCATTTTCTGGATTAATTTCTTAATTGTTATTGTATGTTATACACTCATTACAAAAGAACTGTACCGGTCATACGTAAGAACGAGGGGTGTAGGTAAAGTCCCCAGGAAAAAGGTGAACGTCAAAGTTTTCATTATCATTGCTGTATTCTTTATTTGTTTTGTTCCTTTCCATTTTGCCCGAATTCCTTACACCCTGAGCCAAACCCGGGATGTCTTTGACTGCACTGCTGAAAATACTCTGTTCTATGTGAAAGAGAGCACTCTGTGGTTAACTTCCTTAAATGCATGCCTGGATCCGTTCATCTATTTTTTCCTTTGCAAGTCCTTCAGAAATTCCTTGATAAGTATGCTGAAGTGCCCCAATTCTGCAACATCTCTGTCCCAGGACAATAGGAAAAAAGAACAGGATGGTGGTGACCCAAATGAAGAGACTCCAATGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T46937-Ab | Anti-P2Y12/ P2RY12/ ADPG-R monoclonal antibody |
Target Antigen | GM-Tg-g-T46937-Ag | P2RY12 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003557 | Human P2RY12 Lentivirus plasmid |
ORF Viral Vector | vGMLP003557 | Human P2RY12 Lentivirus particle |
Target information
Target ID | GM-T46937 |
Target Name | P2RY12 |
Gene ID | 64805, 70839, 710036, 64803, 101094044, 442958, 408007, 100630046 |
Gene Symbol and Synonyms | 2900079B22Rik,4921504D23Rik,ADPG-R,BDPLT8,HORK3,P2RY12,P2T(AC),P2Y(12)R,P2Y(AC),P2Y(ADP),P2Y(cyc),P2Y12,SP1999 |
Uniprot Accession | Q9H244 |
Uniprot Entry Name | P2Y12_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169313 |
Target Classification | GPCR |
The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.