Human P2RY12/ADPG-R/ BDPLT8 ORF/cDNA clone-Lentivirus particle (NM_022788)

Pre-made Human P2RY12/ADPG-R/ BDPLT8 Lentiviral expression plasmid for P2RY12 lentivirus packaging, P2RY12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to P2RY12/ADPG-R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003557 Human P2RY12 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003557
Gene Name P2RY12
Accession Number NM_022788
Gene ID 64805
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1029 bp
Gene Alias ADPG-R, BDPLT8, HORK3, P2T(AC), P2Y(12)R, P2Y(AC), P2Y(ADP), P2Y(cyc), P2Y12, SP1999
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAAGCCGTCGACAACCTCACCTCTGCGCCTGGTAACACCAGTCTGTGCACCAGAGACTACAAAATCACCCAGGTCCTCTTCCCACTGCTCTACACTGTCCTGTTTTTTGTTGGACTTATCACAAATGGCCTGGCGATGAGGATTTTCTTTCAAATCCGGAGTAAATCAAACTTTATTATTTTTCTTAAGAACACAGTCATTTCTGATCTTCTCATGATTCTGACTTTTCCATTCAAAATTCTTAGTGATGCCAAACTGGGAACAGGACCACTGAGAACTTTTGTGTGTCAAGTTACCTCCGTCATATTTTATTTCACAATGTATATCAGTATTTCATTCCTGGGACTGATAACTATCGATCGCTACCAGAAGACCACCAGGCCATTTAAAACATCCAACCCCAAAAATCTCTTGGGGGCTAAGATTCTCTCTGTTGTCATCTGGGCATTCATGTTCTTACTCTCTTTGCCTAACATGATTCTGACCAACAGGCAGCCGAGAGACAAGAATGTGAAGAAATGCTCTTTCCTTAAATCAGAGTTCGGTCTAGTCTGGCATGAAATAGTAAATTACATCTGTCAAGTCATTTTCTGGATTAATTTCTTAATTGTTATTGTATGTTATACACTCATTACAAAAGAACTGTACCGGTCATACGTAAGAACGAGGGGTGTAGGTAAAGTCCCCAGGAAAAAGGTGAACGTCAAAGTTTTCATTATCATTGCTGTATTCTTTATTTGTTTTGTTCCTTTCCATTTTGCCCGAATTCCTTACACCCTGAGCCAAACCCGGGATGTCTTTGACTGCACTGCTGAAAATACTCTGTTCTATGTGAAAGAGAGCACTCTGTGGTTAACTTCCTTAAATGCATGCCTGGATCCGTTCATCTATTTTTTCCTTTGCAAGTCCTTCAGAAATTCCTTGATAAGTATGCTGAAGTGCCCCAATTCTGCAACATCTCTGTCCCAGGACAATAGGAAAAAAGAACAGGATGGTGGTGACCCAAATGAAGAGACTCCAATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T46937-Ab Anti-P2Y12/ P2RY12/ ADPG-R monoclonal antibody
    Target Antigen GM-Tg-g-T46937-Ag P2RY12 VLP (virus-like particle)
    ORF Viral Vector pGMLP003557 Human P2RY12 Lentivirus plasmid
    ORF Viral Vector vGMLP003557 Human P2RY12 Lentivirus particle


    Target information

    Target ID GM-T46937
    Target Name P2RY12
    Gene ID 64805, 70839, 710036, 64803, 101094044, 442958, 408007, 100630046
    Gene Symbol and Synonyms 2900079B22Rik,4921504D23Rik,ADPG-R,BDPLT8,HORK3,P2RY12,P2T(AC),P2Y(12)R,P2Y(AC),P2Y(ADP),P2Y(cyc),P2Y12,SP1999
    Uniprot Accession Q9H244
    Uniprot Entry Name P2Y12_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169313
    Target Classification GPCR

    The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.