Human CA12/CA-XII/ CAXII ORF/cDNA clone-Lentivirus plasmid (NM_001218)

Pre-made Human CA12/CA-XII/ CAXII Lentiviral expression plasmid for CA12 lentivirus packaging, CA12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CA-XII/CA12 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003574 Human CA12 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003574
Gene Name CA12
Accession Number NM_001218
Gene ID 771
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1065 bp
Gene Alias CA-XII, CAXII, HsT18816, T18816
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCCGGCGCAGCCTGCACGCGGCGGCCGTGCTCCTGCTGGTGATCTTAAAGGAACAGCCTTCCAGCCCGGCCCCAGTGAACGGTTCCAAGTGGACTTATTTTGGTCCTGATGGGGAGAATAGCTGGTCCAAGAAGTACCCGTCGTGTGGGGGCCTGCTGCAGTCCCCCATAGACCTGCACAGTGACATCCTCCAGTATGACGCCAGCCTCACGCCCCTCGAGTTCCAAGGCTACAATCTGTCTGCCAACAAGCAGTTTCTCCTGACCAACAATGGCCATTCAGTGAAGCTGAACCTGCCCTCGGACATGCACATCCAGGGCCTCCAGTCTCGCTACAGTGCCACGCAGCTGCACCTGCACTGGGGGAACCCGAATGACCCGCACGGCTCTGAGCACACCGTCAGCGGACAGCACTTCGCCGCCGAGCTGCACATTGTCCATTATAACTCAGACCTTTATCCTGACGCCAGCACTGCCAGCAACAAGTCAGAAGGCCTCGCTGTCCTGGCTGTTCTCATTGAGATGGGCTCCTTCAATCCGTCCTATGACAAGATCTTCAGTCACCTTCAACATGTAAAGTACAAAGGCCAGGAAGCATTCGTCCCGGGATTCAACATTGAAGAGCTGCTTCCGGAGAGGACCGCTGAATATTACCGCTACCGGGGGTCCCTGACCACACCCCCTTGCAACCCCACTGTGCTCTGGACAGTTTTCCGAAACCCCGTGCAAATTTCCCAGGAGCAGCTGCTGGCTTTGGAGACAGCCCTGTACTGCACACACATGGACGACCCTTCCCCCAGAGAAATGATCAACAACTTCCGGCAGGTCCAGAAGTTCGATGAGAGGCTGGTATACACCTCCTTCTCCCAAGTGCAAGTCTGTACTGCGGCAGGACTGAGTCTGGGCATCATCCTCTCACTGGCCCTGGCTGGCATTCTTGGCATCTGTATTGTGGTGGTGGTGTCCATTTGGCTTTTCAGAAGGAAGAGTATCAAAAAAGGTGATAACAAGGGAGTCATTTACAAGCCAGCCACCAAGATGGAGACTGAGGCCCACGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16987-Ab Anti-CAH12/ CA-XII/ CA12 monoclonal antibody
    Target Antigen GM-Tg-g-T16987-Ag CA-XII/CA12 VLP (virus-like particle)
    ORF Viral Vector pGMLP003574 Human CA12 Lentivirus plasmid
    ORF Viral Vector vGMLP003574 Human CA12 Lentivirus particle


    Target information

    Target ID GM-T16987
    Target Name CA-XII
    Gene ID 771, 76459, 705838, 363085, 101090522, 478333, 614323, 100054028
    Gene Symbol and Synonyms 2310047E01Rik,CA-XII,CA12,Car12,CAXII,HsT18816,T18816
    Uniprot Accession O43570
    Uniprot Entry Name CAH12_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000074410
    Target Classification Not Available

    Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. This gene product is a type I membrane protein that is highly expressed in normal tissues, such as kidney, colon and pancreas, and has been found to be overexpressed in 10% of clear cell renal carcinomas. Three transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.