Human PTGER2/EP2 ORF/cDNA clone-Lentivirus plasmid (NM_000956)

Pre-made Human PTGER2/EP2 Lentiviral expression plasmid for PTGER2 lentivirus packaging, PTGER2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PTGER2/EP2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003585 Human PTGER2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003585
Gene Name PTGER2
Accession Number NM_000956
Gene ID 5732
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1077 bp
Gene Alias EP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAATGCCTCCAATGACTCCCAGTCTGAGGACTGCGAGACGCGACAGTGGCTTCCCCCAGGCGAAAGCCCAGCCATCAGCTCCGTCATGTTCTCGGCCGGGGTGCTGGGGAACCTCATAGCACTGGCGCTGCTGGCGCGCCGCTGGCGGGGGGACGTGGGGTGCAGCGCCGGCCGCAGGAGCTCCCTCTCCTTGTTCCACGTGCTGGTGACCGAGCTGGTGTTCACCGACCTGCTCGGGACCTGCCTCATCAGCCCAGTGGTACTGGCTTCGTACGCGCGGAACCAGACCCTGGTGGCACTGGCGCCCGAGAGCCGCGCGTGCACCTACTTCGCTTTCGCCATGACCTTCTTCAGCCTGGCCACGATGCTCATGCTCTTCGCCATGGCCCTGGAGCGCTACCTCTCGATCGGGCACCCCTACTTCTACCAGCGCCGCGTCTCGCGCTCCGGGGGCCTGGCCGTGCTGCCTGTCATCTATGCAGTCTCCCTGCTCTTCTGCTCGCTGCCGCTGCTGGACTATGGGCAGTACGTCCAGTACTGCCCCGGGACCTGGTGCTTCATCCGGCACGGGCGGACCGCTTACCTGCAGCTGTACGCCACCCTGCTGCTGCTTCTCATTGTCTCGGTGCTCGCCTGCAACTTCAGTGTCATTCTCAACCTCATCCGCATGCACCGCCGAAGCCGGAGAAGCCGCTGCGGACCTTCCCTGGGCAGTGGCCGGGGCGGCCCCGGGGCCCGCAGGAGAGGGGAAAGGGTGTCCATGGCGGAGGAGACGGACCACCTCATTCTCCTGGCTATCATGACCATCACCTTCGCCGTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38529-Ab Anti-PE2R2/ PTGER2/ EP2 monoclonal antibody
    Target Antigen GM-Tg-g-T38529-Ag PTGER2 VLP (virus-like particle)
    ORF Viral Vector pGMAD000775 Human PTGER2 Adenovirus plasmid
    ORF Viral Vector pGMLP003585 Human PTGER2 Lentivirus plasmid
    ORF Viral Vector vGMAD000775 Human PTGER2 Adenovirus particle
    ORF Viral Vector vGMLP003585 Human PTGER2 Lentivirus particle


    Target information

    Target ID GM-T38529
    Target Name PTGER2
    Gene ID 5732, 19217, 708024, 81752, 100169967, 403797, 282329, 100067279
    Gene Symbol and Synonyms EP2,Ptger-ep2,PTGER2,Ptgerep2
    Uniprot Accession P43116
    Uniprot Entry Name PE2R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000125384
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.