Human PTGER2/EP2 ORF/cDNA clone-Adenovirus particle (NM_000956)

Pre-made Human PTGER2/EP2 Adenovirus for PTGER2 overexpression in-vitro and in-vivo. The PTGER2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PTGER2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to PTGER2/EP2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000775 Human PTGER2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000775
Gene Name PTGER2
Accession Number NM_000956
Gene ID 5732
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1077 bp
Gene Alias EP2
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAATGCCTCCAATGACTCCCAGTCTGAGGACTGCGAGACGCGACAGTGGCTTCCCCCAGGCGAAAGCCCAGCCATCAGCTCCGTCATGTTCTCGGCCGGGGTGCTGGGGAACCTCATAGCACTGGCGCTGCTGGCGCGCCGCTGGCGGGGGGACGTGGGGTGCAGCGCCGGCCGCAGGAGCTCCCTCTCCTTGTTCCACGTGCTGGTGACCGAGCTGGTGTTCACCGACCTGCTCGGGACCTGCCTCATCAGCCCAGTGGTACTGGCTTCGTACGCGCGGAACCAGACCCTGGTGGCACTGGCGCCCGAGAGCCGCGCGTGCACCTACTTCGCTTTCGCCATGACCTTCTTCAGCCTGGCCACGATGCTCATGCTCTTCGCCATGGCCCTGGAGCGCTACCTCTCGATCGGGCACCCCTACTTCTACCAGCGCCGCGTCTCGCGCTCCGGGGGCCTGGCCGTGCTGCCTGTCATCTATGCAGTCTCCCTGCTCTTCTGCTCGCTGCCGCTGCTGGACTATGGGCAGTACGTCCAGTACTGCCCCGGGACCTGGTGCTTCATCCGGCACGGGCGGACCGCTTACCTGCAGCTGTACGCCACCCTGCTGCTGCTTCTCATTGTCTCGGTGCTCGCCTGCAACTTCAGTGTCATTCTCAACCTCATCCGCATGCACCGCCGAAGCCGGAGAAGCCGCTGCGGACCTTCCCTGGGCAGTGGCCGGGGCGGCCCCGGGGCCCGCAGGAGAGGGGAAAGGGTGTCCATGGCGGAGGAGACGGACCACCTCATTCTCCTGGCTATCATGACCATCACCTTCGCCGTCTGCTCCTTGCCTTTCACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCTCTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCTCCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGATGCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38529-Ab Anti-PE2R2/ PTGER2/ EP2 monoclonal antibody
    Target Antigen GM-Tg-g-T38529-Ag PTGER2 VLP (virus-like particle)
    ORF Viral Vector pGMAD000775 Human PTGER2 Adenovirus plasmid
    ORF Viral Vector pGMLP003585 Human PTGER2 Lentivirus plasmid
    ORF Viral Vector vGMAD000775 Human PTGER2 Adenovirus particle
    ORF Viral Vector vGMLP003585 Human PTGER2 Lentivirus particle


    Target information

    Target ID GM-T38529
    Target Name PTGER2
    Gene ID 5732, 19217, 708024, 81752, 100169967, 403797, 282329, 100067279
    Gene Symbol and Synonyms EP2,Ptger-ep2,PTGER2,Ptgerep2
    Uniprot Accession P43116
    Uniprot Entry Name PE2R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000125384
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.