Human CNR2/CB-2/ CB2 ORF/cDNA clone-Lentivirus plasmid (NM_001841)
Pre-made Human CNR2/CB-2/ CB2 Lentiviral expression plasmid for CNR2 lentivirus packaging, CNR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CB2/CNR2/CB-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003590 | Human CNR2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003590 |
Gene Name | CNR2 |
Accession Number | NM_001841 |
Gene ID | 1269 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1083 bp |
Gene Alias | CB-2, CB2, CX5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGAATGCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGCACTAGTCTCCTACCTGCCCCTCATGGGATGGACTTGCTGTCCCAGGCCCTGCTCTGAGCTTTTCCCACTGATCCCCAATGACTACCTGCTGAGCTGGCTCCTGTTCATCGCCTTCCTCTTTTCCGGAATCATCTACACCTATGGGCATGTTCTCTGGAAGGCCCATCAGCATGTGGCCAGCTTGTCTGGCCACCAGGACAGGCAGGTGCCAGGAATGGCCCGAATGAGGCTGGATGTGAGGTTGGCCAAGACCCTAGGGCTAGTGTTGGCTGTGCTCCTCATCTGTTGGTTCCCAGTGCTGGCCCTCATGGCCCACAGCCTGGCCACTACGCTCAGTGACCAGGTCAAGAAGGCCTTTGCTTTCTGCTCCATGCTGTGCCTCATCAACTCCATGGTCAACCCTGTCATCTATGCTCTACGGAGTGGAGAGATCCGCTCCTCTGCCCATCACTGCCTGGCTCACTGGAAGAAGTGTGTGAGGGGCCTTGGGTCAGAGGCAAAAGAAGAAGCCCCGAGATCCTCAGTCACCGAGACAGAGGCTGATGGGAAAATCACTCCGTGGCCAGATTCCAGAGATCTAGACCTCTCTGATTGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T37693-Ab | Anti-CNR2/ CB2/ CB-2 monoclonal antibody |
Target Antigen | GM-Tg-g-T37693-Ag | CB2/CNR2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003590 | Human CNR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP003590 | Human CNR2 Lentivirus particle |
Target information
Target ID | GM-T37693 |
Target Name | CB2 |
Gene ID | 1269, 12802, 711155, 57302, 101100234, 612289, 539769, 100071536 |
Gene Symbol and Synonyms | CB-2,CB2,CB2-R,CB2C,CNR2,CNR2C,CX5 |
Uniprot Accession | P34972 |
Uniprot Entry Name | CNR2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000188822 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.