Human CNR2/CB-2/ CB2 ORF/cDNA clone-Lentivirus plasmid (NM_001841)

Pre-made Human CNR2/CB-2/ CB2 Lentiviral expression plasmid for CNR2 lentivirus packaging, CNR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CB2/CNR2/CB-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003590 Human CNR2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003590
Gene Name CNR2
Accession Number NM_001841
Gene ID 1269
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1083 bp
Gene Alias CB-2, CB2, CX5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGAATGCTGGGTGACAGAGATAGCCAATGGCTCCAAGGATGGCTTGGATTCCAACCCTATGAAGGATTACATGATCCTGAGTGGTCCCCAGAAGACAGCTGTTGCTGTGTTGTGCACTCTTCTGGGCCTGCTAAGTGCCCTGGAGAACGTGGCTGTGCTCTATCTGATCCTGTCCTCCCACCAACTCCGCCGGAAGCCCTCATACCTGTTCATTGGCAGCTTGGCTGGGGCTGACTTCCTGGCCAGTGTGGTCTTTGCATGCAGCTTTGTGAATTTCCATGTTTTCCATGGTGTGGATTCCAAGGCTGTCTTCCTGCTGAAGATTGGCAGCGTGACTATGACCTTCACAGCCTCTGTGGGTAGCCTCCTGCTGACCGCCATTGACCGATACCTCTGCCTGCGCTATCCACCTTCCTACAAAGCTCTGCTCACCCGTGGAAGGGCACTGGTGACCCTGGGCATCATGTGGGTCCTCTCAGCACTAGTCTCCTACCTGCCCCTCATGGGATGGACTTGCTGTCCCAGGCCCTGCTCTGAGCTTTTCCCACTGATCCCCAATGACTACCTGCTGAGCTGGCTCCTGTTCATCGCCTTCCTCTTTTCCGGAATCATCTACACCTATGGGCATGTTCTCTGGAAGGCCCATCAGCATGTGGCCAGCTTGTCTGGCCACCAGGACAGGCAGGTGCCAGGAATGGCCCGAATGAGGCTGGATGTGAGGTTGGCCAAGACCCTAGGGCTAGTGTTGGCTGTGCTCCTCATCTGTTGGTTCCCAGTGCTGGCCCTCATGGCCCACAGCCTGGCCACTACGCTCAGTGACCAGGTCAAGAAGGCCTTTGCTTTCTGCTCCATGCTGTGCCTCATCAACTCCATGGTCAACCCTGTCATCTATGCTCTACGGAGTGGAGAGATCCGCTCCTCTGCCCATCACTGCCTGGCTCACTGGAAGAAGTGTGTGAGGGGCCTTGGGTCAGAGGCAAAAGAAGAAGCCCCGAGATCCTCAGTCACCGAGACAGAGGCTGATGGGAAAATCACTCCGTGGCCAGATTCCAGAGATCTAGACCTCTCTGATTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T37693-Ab Anti-CNR2/ CB2/ CB-2 monoclonal antibody
    Target Antigen GM-Tg-g-T37693-Ag CB2/CNR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003590 Human CNR2 Lentivirus plasmid
    ORF Viral Vector vGMLP003590 Human CNR2 Lentivirus particle


    Target information

    Target ID GM-T37693
    Target Name CB2
    Gene ID 1269, 12802, 711155, 57302, 101100234, 612289, 539769, 100071536
    Gene Symbol and Synonyms CB-2,CB2,CB2-R,CB2C,CNR2,CNR2C,CX5
    Uniprot Accession P34972
    Uniprot Entry Name CNR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000188822
    Target Classification Checkpoint-Immuno Oncology, GPCR

    The cannabinoid delta-9-tetrahydrocannabinol is the principal psychoactive ingredient of marijuana. The proteins encoded by this gene and the cannabinoid receptor 1 (brain) (CNR1) gene have the characteristics of a guanine nucleotide-binding protein (G-protein)-coupled receptor for cannabinoids. They inhibit adenylate cyclase activity in a dose-dependent, stereoselective, and pertussis toxin-sensitive manner. These proteins have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. The cannabinoid receptors are members of family 1 of the G-protein-coupled receptors. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.