Human SSTR5/SS-5-R ORF/cDNA clone-Lentivirus plasmid (NM_001172560)

Pre-made Human SSTR5/SS-5-R Lentiviral expression plasmid for SSTR5 lentivirus packaging, SSTR5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SSTR5/SS-5-R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003594 Human SSTR5 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003594
Gene Name SSTR5
Accession Number NM_001172560
Gene ID 6755
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1095 bp
Gene Alias SS-5-R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCCCCTGTTCCCAGCCTCCACGCCCAGCTGGAACGCCTCCTCCCCGGGGGCTGCCTCTGGAGGCGGTGACAACAGGACGCTGGTGGGGCCGGCGCCCTCGGCAGGGGCCCGGGCGGTGCTGGTGCCCGTGCTGTACCTGCTGGTGTGTGCGGCCGGGCTGGGCGGGAACACGCTGGTCATCTACGTGGTGCTGCGCTTCGCCAAGATGAAGACCGTCACCAACATCTACATTCTCAACCTGGCAGTGGCCGACGTCCTGTACATGCTGGGGCTGCCTTTCCTGGCCACGCAGAACGCCGCGTCCTTCTGGCCCTTCGGCCCCGTCCTGTGCCGCCTGGTCATGACGCTGGACGGCGTCAACCAGTTCACCAGTGTCTTCTGCCTGACAGTCATGAGCGTGGACCGCTACCTGGCAGTGGTGCACCCGCTGAGCTCGGCCCGCTGGCGCCGCCCGCGTGTGGCCAAGCTGGCGAGCGCCGCGGCCTGGGTCCTGTCTCTGTGCATGTCGCTGCCGCTCCTGGTGTTCGCGGACGTGCAGGAGGGCGGTACCTGCAACGCCAGCTGGCCGGAGCCCGTGGGGCTGTGGGGCGCCGTCTTCATCATCTACACGGCCGTGCTGGGCTTCTTCGCGCCGCTGCTGGTCATCTGCCTGTGCTACCTGCTCATCGTGGTGAAGGTGAGGGCGGCGGGCGTGCGCGTGGGCTGCGTGCGGCGGCGCTCGGAGCGGAAGGTGACGCGCATGGTGTTGGTGGTGGTGCTGGTGTTTGCGGGATGTTGGCTGCCCTTCTTCACCGTCAACATCGTCAACCTGGCCGTGGCGCTGCCCCAGGAGCCCGCCTCCGCCGGCCTCTACTTCTTCGTGGTCATCCTCTCCTACGCCAACAGCTGTGCCAACCCCGTCCTCTACGGCTTCCTCTCTGACAACTTCCGCCAGAGCTTCCAGAAGGTTCTGTGCCTCCGCAAGGGCTCTGGTGCCAAGGACGCTGACGCCACGGAGCCGCGTCCAGACAGGATCCGGCAGCAGCAGGAGGCCACGCCACCCGCGCACCGCGCCGCAGCCAACGGGCTTATGCAGACCAGCAAGCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64830-Ab Anti-SSR5/ SSTR5/ SS-5-R monoclonal antibody
    Target Antigen GM-Tg-g-T64830-Ag SSTR5 VLP (virus-like particle)
    ORF Viral Vector pGMLP003594 Human SSTR5 Lentivirus plasmid
    ORF Viral Vector vGMLP003594 Human SSTR5 Lentivirus particle


    Target information

    Target ID GM-T64830
    Target Name SSTR5
    Gene ID 6755, 20609, 106994905, 25354, 101090317, 403454, 510344, 100067398
    Gene Symbol and Synonyms Smstr5,Somato,SS-5-R,SS5-R,SS5R,SST5,SSTR5
    Uniprot Accession P35346
    Uniprot Entry Name SSR5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000162009
    Target Classification GPCR, Tumor-associated antigen (TAA)

    Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.