Human SSTR5/SS-5-R ORF/cDNA clone-Lentivirus particle (NM_001172560)
Pre-made Human SSTR5/SS-5-R Lentiviral expression plasmid for SSTR5 lentivirus packaging, SSTR5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SSTR5/SS-5-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003594 | Human SSTR5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003594 |
Gene Name | SSTR5 |
Accession Number | NM_001172560 |
Gene ID | 6755 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1095 bp |
Gene Alias | SS-5-R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCCCCTGTTCCCAGCCTCCACGCCCAGCTGGAACGCCTCCTCCCCGGGGGCTGCCTCTGGAGGCGGTGACAACAGGACGCTGGTGGGGCCGGCGCCCTCGGCAGGGGCCCGGGCGGTGCTGGTGCCCGTGCTGTACCTGCTGGTGTGTGCGGCCGGGCTGGGCGGGAACACGCTGGTCATCTACGTGGTGCTGCGCTTCGCCAAGATGAAGACCGTCACCAACATCTACATTCTCAACCTGGCAGTGGCCGACGTCCTGTACATGCTGGGGCTGCCTTTCCTGGCCACGCAGAACGCCGCGTCCTTCTGGCCCTTCGGCCCCGTCCTGTGCCGCCTGGTCATGACGCTGGACGGCGTCAACCAGTTCACCAGTGTCTTCTGCCTGACAGTCATGAGCGTGGACCGCTACCTGGCAGTGGTGCACCCGCTGAGCTCGGCCCGCTGGCGCCGCCCGCGTGTGGCCAAGCTGGCGAGCGCCGCGGCCTGGGTCCTGTCTCTGTGCATGTCGCTGCCGCTCCTGGTGTTCGCGGACGTGCAGGAGGGCGGTACCTGCAACGCCAGCTGGCCGGAGCCCGTGGGGCTGTGGGGCGCCGTCTTCATCATCTACACGGCCGTGCTGGGCTTCTTCGCGCCGCTGCTGGTCATCTGCCTGTGCTACCTGCTCATCGTGGTGAAGGTGAGGGCGGCGGGCGTGCGCGTGGGCTGCGTGCGGCGGCGCTCGGAGCGGAAGGTGACGCGCATGGTGTTGGTGGTGGTGCTGGTGTTTGCGGGATGTTGGCTGCCCTTCTTCACCGTCAACATCGTCAACCTGGCCGTGGCGCTGCCCCAGGAGCCCGCCTCCGCCGGCCTCTACTTCTTCGTGGTCATCCTCTCCTACGCCAACAGCTGTGCCAACCCCGTCCTCTACGGCTTCCTCTCTGACAACTTCCGCCAGAGCTTCCAGAAGGTTCTGTGCCTCCGCAAGGGCTCTGGTGCCAAGGACGCTGACGCCACGGAGCCGCGTCCAGACAGGATCCGGCAGCAGCAGGAGGCCACGCCACCCGCGCACCGCGCCGCAGCCAACGGGCTTATGCAGACCAGCAAGCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T64830-Ab | Anti-SSR5/ SSTR5/ SS-5-R monoclonal antibody |
Target Antigen | GM-Tg-g-T64830-Ag | SSTR5 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003594 | Human SSTR5 Lentivirus plasmid |
ORF Viral Vector | vGMLP003594 | Human SSTR5 Lentivirus particle |
Target information
Target ID | GM-T64830 |
Target Name | SSTR5 |
Gene ID | 6755, 20609, 106994905, 25354, 101090317, 403454, 510344, 100067398 |
Gene Symbol and Synonyms | Smstr5,Somato,SS-5-R,SS5-R,SS5R,SST5,SSTR5 |
Uniprot Accession | P35346 |
Uniprot Entry Name | SSR5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000162009 |
Target Classification | GPCR, Tumor-associated antigen (TAA) |
Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.