Human IHH/BDA1/HHG2 ORF/cDNA clone-Lentivirus plasmid (NM_002181)

Cat. No.: pGMLP003659
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IHH/BDA1/HHG2 Lentiviral expression plasmid for IHH lentivirus packaging, IHH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IHH/BDA1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $646.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003659
Gene Name IHH
Accession Number NM_002181
Gene ID 3549
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1236 bp
Gene Alias BDA1,HHG2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTCCCGCCCGGCTCCGGCCCCGACTGCACTTCTGCCTGGTCCTGTTGCTGCTGCTGGTGGTGCCGGCGGCATGGGGCTGCGGGCCGGGTCGGGTGGTGGGCAGCCGCCGGCGACCGCCACGCAAACTCGTGCCGCTCGCCTACAAGCAGTTCAGCCCCAATGTGCCCGAGAAGACCCTGGGCGCCAGCGGACGCTATGAAGGCAAGATCGCTCGCAGCTCCGAGCGCTTCAAGGAGCTCACCCCCAATTACAATCCAGACATCATCTTCAAGGACGAGGAGAACACAGGCGCCGACCGCCTCATGACCCAGCGCTGCAAGGACCGCCTGAACTCGCTGGCTATCTCGGTGATGAACCAGTGGCCCGGTGTGAAGCTGCGGGTGACCGAGGGCTGGGACGAGGACGGCCACCACTCAGAGGAGTCCCTGCATTATGAGGGCCGCGCGGTGGACATCACCACATCAGACCGCGACCGCAATAAGTATGGACTGCTGGCGCGCTTGGCAGTGGAGGCCGGCTTTGACTGGGTGTATTACGAGTCAAAGGCCCACGTGCATTGCTCCGTCAAGTCCGAGCACTCGGCCGCAGCCAAGACGGGCGGCTGCTTCCCTGCCGGAGCCCAGGTACGCCTGGAGAGTGGGGCGCGTGTGGCCTTGTCAGCCGTGAGGCCGGGAGACCGTGTGCTGGCCATGGGGGAGGATGGGAGCCCCACCTTCAGCGATGTGCTCATTTTCCTGGACCGCGAGCCTCACAGGCTGAGAGCCTTCCAGGTCATCGAGACTCAGGACCCCCCACGCCGCCTGGCACTCACACCCGCTCACCTGCTCTTTACGGCTGACAATCACACGGAGCCGGCAGCCCGCTTCCGGGCCACATTTGCCAGCCACGTGCAGCCTGGCCAGTACGTGCTGGTGGCTGGGGTGCCAGGCCTGCAGCCTGCCCGCGTGGCAGCTGTCTCTACACACGTGGCCCTCGGGGCCTACGCCCCGCTCACAAAGCATGGGACACTGGTGGTGGAGGATGTGGTGGCATCCTGCTTCGCGGCCGTGGCTGACCACCACCTGGCTCAGTTGGCCTTCTGGCCCCTGAGACTCTTTCACAGCTTGGCATGGGGCAGCTGGACTCCGGGGGAGGGTGTGCATTGGTACCCCCAGCTGCTCTACCGCCTGGGGCGTCTCCTGCTAGAAGAGGGCAGCTTCCACCCACTGGGCATGTCCGGGGCAGGGAGCTGA
ORF Protein Sequence MSPARLRPRLHFCLVLLLLLVVPAAWGCGPGRVVGSRRRPPRKLVPLAYKQFSPNVPEKTLGASGRYEGKIARSSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDRLNSLAISVMNQWPGVKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRNKYGLLARLAVEAGFDWVYYESKAHVHCSVKSEHSAAAKTGGCFPAGAQVRLESGARVALSAVRPGDRVLAMGEDGSPTFSDVLIFLDREPHRLRAFQVIETQDPPRRLALTPAHLLFTADNHTEPAARFRATFASHVQPGQYVLVAGVPGLQPARVAAVSTHVALGAYAPLTKHGTLVVEDVVASCFAAVADHHLAQLAFWPLRLFHSLAWGSWTPGEGVHWYPQLLYRLGRLLLEEGSFHPLGMSGAGS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0618-Ab Anti-IHH/ BDA1/ HHG2 monoclonal antibody
    Target Antigen GM-Tg-g-MP0618-Ag IHH VLP (virus-like particle)
    ORF Viral Vector pGMLP003659 Human IHH Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-073 Human IHH Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-213 Human IHH Adenovirus plasmid
    ORF Viral Vector vGMLP003659 Human IHH Lentivirus particle
    ORF Viral Vector vGMLP-SPh-073 Human IHH Lentivirus particle
    ORF Viral Vector vGMAP-SPh-213 Human IHH Adenovirus particle


    Target information

    Target ID GM-MP0618
    Target Name IHH
    Gene ID 3549, 16147, 704046, 84399, 101100146, 488533, 522714, 100033984
    Gene Symbol and Synonyms BDA1,HHG-2,HHG2,IHH
    Uniprot Accession Q14623
    Uniprot Entry Name IHH_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163501
    Target Classification Not Available

    This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.