Human IHH/BDA1/HHG2 ORF/cDNA clone-Adenovirus plasmid (NM_002181)
Cat. No.: pGMAP-SPh-213
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IHH/BDA1/HHG2 adenoviral expression plasmid for IHH adenovirus packaging, IHH adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
IHH/BDA1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP-SPh-213 |
| Gene Name | IHH |
| Accession Number | NM_002181 |
| Gene ID | 3549 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 1236 bp |
| Gene Alias | BDA1,HHG2 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCTCCCGCCCGGCTCCGGCCCCGACTGCACTTCTGCCTGGTCCTGTTGCTGCTGCTGGTGGTGCCGGCGGCATGGGGCTGCGGGCCGGGTCGGGTGGTGGGCAGCCGCCGGCGACCGCCACGCAAACTCGTGCCGCTCGCCTACAAGCAGTTCAGCCCCAATGTGCCCGAGAAGACCCTGGGCGCCAGCGGACGCTATGAAGGCAAGATCGCTCGCAGCTCCGAGCGCTTCAAGGAGCTCACCCCCAATTACAATCCAGACATCATCTTCAAGGACGAGGAGAACACAGGCGCCGACCGCCTCATGACCCAGCGCTGCAAGGACCGCCTGAACTCGCTGGCTATCTCGGTGATGAACCAGTGGCCCGGTGTGAAGCTGCGGGTGACCGAGGGCTGGGACGAGGACGGCCACCACTCAGAGGAGTCCCTGCATTATGAGGGCCGCGCGGTGGACATCACCACATCAGACCGCGACCGCAATAAGTATGGACTGCTGGCGCGCTTGGCAGTGGAGGCCGGCTTTGACTGGGTGTATTACGAGTCAAAGGCCCACGTGCATTGCTCCGTCAAGTCCGAGCACTCGGCCGCAGCCAAGACGGGCGGCTGCTTCCCTGCCGGAGCCCAGGTACGCCTGGAGAGTGGGGCGCGTGTGGCCTTGTCAGCCGTGAGGCCGGGAGACCGTGTGCTGGCCATGGGGGAGGATGGGAGCCCCACCTTCAGCGATGTGCTCATTTTCCTGGACCGCGAGCCTCACAGGCTGAGAGCCTTCCAGGTCATCGAGACTCAGGACCCCCCACGCCGCCTGGCACTCACACCCGCTCACCTGCTCTTTACGGCTGACAATCACACGGAGCCGGCAGCCCGCTTCCGGGCCACATTTGCCAGCCACGTGCAGCCTGGCCAGTACGTGCTGGTGGCTGGGGTGCCAGGCCTGCAGCCTGCCCGCGTGGCAGCTGTCTCTACACACGTGGCCCTCGGGGCCTACGCCCCGCTCACAAAGCATGGGACACTGGTGGTGGAGGATGTGGTGGCATCCTGCTTCGCGGCCGTGGCTGACCACCACCTGGCTCAGTTGGCCTTCTGGCCCCTGAGACTCTTTCACAGCTTGGCATGGGGCAGCTGGACTCCGGGGGAGGGTGTGCATTGGTACCCCCAGCTGCTCTACCGCCTGGGGCGTCTCCTGCTAGAAGAGGGCAGCTTCCACCCACTGGGCATGTCCGGGGCAGGGAGCTGA |
| ORF Protein Sequence | MSPARLRPRLHFCLVLLLLLVVPAAWGCGPGRVVGSRRRPPRKLVPLAYKQFSPNVPEKTLGASGRYEGKIARSSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDRLNSLAISVMNQWPGVKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRNKYGLLARLAVEAGFDWVYYESKAHVHCSVKSEHSAAAKTGGCFPAGAQVRLESGARVALSAVRPGDRVLAMGEDGSPTFSDVLIFLDREPHRLRAFQVIETQDPPRRLALTPAHLLFTADNHTEPAARFRATFASHVQPGQYVLVAGVPGLQPARVAAVSTHVALGAYAPLTKHGTLVVEDVVASCFAAVADHHLAQLAFWPLRLFHSLAWGSWTPGEGVHWYPQLLYRLGRLLLEEGSFHPLGMSGAGS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0618-Ab | Anti-IHH/ BDA1/ HHG2 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0618-Ag | IHH VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003659 | Human IHH Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-073 | Human IHH Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-213 | Human IHH Adenovirus plasmid |
| ORF Viral Vector | vGMLP003659 | Human IHH Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-073 | Human IHH Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-213 | Human IHH Adenovirus particle |
Target information
| Target ID | GM-MP0618 |
| Target Name | IHH |
| Gene ID | 3549, 16147, 704046, 84399, 101100146, 488533, 522714, 100033984 |
| Gene Symbol and Synonyms | BDA1,HHG-2,HHG2,IHH |
| Uniprot Accession | Q14623 |
| Uniprot Entry Name | IHH_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000163501 |
| Target Classification | Not Available |
This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


