Human DRD4/D4DR ORF/cDNA clone-Lentivirus plasmid (NM_000797)
Pre-made Human DRD4/D4DR Lentiviral expression plasmid for DRD4 lentivirus packaging, DRD4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to D4R/DRD4/D4DR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003674 | Human DRD4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003674 |
Gene Name | DRD4 |
Accession Number | NM_000797 |
Gene ID | 1815 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1260 bp |
Gene Alias | D4DR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGAACCGCAGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCCGGCCGCGGGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCGGCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAACTCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCCACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCTCTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCGTGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTCATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGACAGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGGAGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCGGCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGCGACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCGTCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTCTACTGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCCAAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCTTCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCCGACTGTGCGCCCGCCGCGCCCAGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCCAACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAGACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGGGAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTGCTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGTCCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTGGGCTACGTCAACAGCGCCCTCAACCCCGTCATCTACACTGTCTTCAACGCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCTGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T24983-Ab | Anti-DRD4/ D4R/ D4DR monoclonal antibody |
Target Antigen | GM-Tg-g-T24983-Ag | D4R/DRD4 VLP (virus-like particle) |
ORF Viral Vector | pGMLP003674 | Human DRD4 Lentivirus plasmid |
ORF Viral Vector | vGMLP003674 | Human DRD4 Lentivirus particle |
Target information
Target ID | GM-T24983 |
Target Name | D4R |
Gene ID | 1815, 13491, 699697, 25432, 111556768, 119864199, 101906668, 100147552 |
Gene Symbol and Synonyms | D4DR,D4R,D4RA,Drd-4,DRD4 |
Uniprot Accession | P21917 |
Uniprot Entry Name | DRD4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000069696 |
Target Classification | Not Available |
This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.