Human DRD4/D4DR ORF/cDNA clone-Lentivirus particle (NM_000797)

Pre-made Human DRD4/D4DR Lentiviral expression plasmid for DRD4 lentivirus packaging, DRD4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to D4R/DRD4/D4DR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003674 Human DRD4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003674
Gene Name DRD4
Accession Number NM_000797
Gene ID 1815
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1260 bp
Gene Alias D4DR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGAACCGCAGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCCGGCCGCGGGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCGGCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAACTCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCCACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCTCTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCGTGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTCATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGACAGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGGAGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCGGCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGCGACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCGTCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTCTACTGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCCAAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCTTCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCCGACTGTGCGCCCGCCGCGCCCAGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCCAACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAGACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGGGAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTGCTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGTCCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTGGGCTACGTCAACAGCGCCCTCAACCCCGTCATCTACACTGTCTTCAACGCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24983-Ab Anti-DRD4/ D4R/ D4DR monoclonal antibody
    Target Antigen GM-Tg-g-T24983-Ag D4R/DRD4 VLP (virus-like particle)
    ORF Viral Vector pGMLP003674 Human DRD4 Lentivirus plasmid
    ORF Viral Vector vGMLP003674 Human DRD4 Lentivirus particle


    Target information

    Target ID GM-T24983
    Target Name D4R
    Gene ID 1815, 13491, 699697, 25432, 111556768, 119864199, 101906668, 100147552
    Gene Symbol and Synonyms D4DR,D4R,D4RA,Drd-4,DRD4
    Uniprot Accession P21917
    Uniprot Entry Name DRD4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000069696
    Target Classification Not Available

    This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.