Human HTR1A/5-HT-1A/ 5-HT1A ORF/cDNA clone-Lentivirus plasmid (NM_000524)
Pre-made Human HTR1A/5-HT-1A/ 5-HT1A Lentiviral expression plasmid for HTR1A lentivirus packaging, HTR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HTR1A/5-HT-1A products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003677 | Human HTR1A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003677 |
Gene Name | HTR1A |
Accession Number | NM_000524 |
Gene ID | 3350 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1269 bp |
Gene Alias | 5-HT-1A, 5-HT1A, 5HT1a, ADRB2RL1, ADRBRL1, G-21, PFMCD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATGTGCTCAGCCCTGGTCAGGGCAACAACACCACATCACCACCGGCTCCCTTTGAGACCGGCGGCAACACTACTGGTATCTCCGACGTGACCGTCAGCTACCAAGTGATCACCTCTCTGCTGCTGGGCACGCTCATCTTCTGCGCGGTGCTGGGCAATGCGTGCGTGGTGGCTGCCATCGCCTTGGAGCGCTCCCTGCAGAACGTGGCCAATTATCTTATTGGCTCTTTGGCGGTCACCGACCTCATGGTGTCGGTGTTGGTGCTGCCCATGGCCGCGCTGTATCAGGTGCTCAACAAGTGGACACTGGGCCAGGTAACCTGCGACCTGTTCATCGCCCTCGACGTGCTGTGCTGCACCTCATCCATCTTGCACCTGTGCGCCATCGCGCTGGACAGGTACTGGGCCATCACGGACCCCATCGACTACGTGAACAAGAGGACGCCCCGGCGCGCCGCTGCGCTCATCTCGCTCACTTGGCTTATTGGCTTCCTCATCTCTATCCCGCCCATGCTGGGCTGGCGCACCCCGGAAGACCGCTCGGACCCCGACGCATGCACCATTAGCAAGGATCATGGCTACACTATCTATTCCACCTTTGGAGCTTTCTACATCCCGCTGCTGCTCATGCTGGTTCTCTATGGGCGCATATTCCGAGCTGCGCGCTTCCGCATCCGCAAGACGGTCAAAAAGGTGGAGAAGACCGGAGCGGACACCCGCCATGGAGCATCTCCCGCCCCGCAGCCCAAGAAGAGTGTGAATGGAGAGTCGGGGAGCAGGAACTGGAGGCTGGGCGTGGAGAGCAAGGCTGGGGGTGCTCTGTGCGCCAATGGCGCGGTGAGGCAAGGTGACGATGGCGCCGCCCTGGAGGTGATCGAGGTGCACCGAGTGGGCAACTCCAAAGAGCACTTGCCTCTGCCCAGCGAGGCTGGTCCTACCCCTTGTGCCCCCGCCTCTTTCGAGAGGAAAAATGAGCGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGCTGGGCATCATCATGGGCACCTTCATCCTCTGCTGGCTGCCCTTCTTCATCGTGGCTCTTGTTCTGCCCTTCTGCGAGAGCAGCTGCCACATGCCCACCCTGTTGGGCGCCATAATCAATTGGCTGGGCTACTCCAACTCTCTGCTTAACCCCGTCATTTACGCATACTTCAACAAGGACTTTCAAAACGCGTTTAAGAAGATCATTAAGTGTAAGTTCTGCCGCCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T78709-Ab | Anti-5HT1A/ HTR1A/ 5-HT-1A monoclonal antibody |
Target Antigen | GM-Tg-g-T78709-Ag | HTR1A VLP (virus-like particle) |
ORF Viral Vector | pGMLP003677 | Human HTR1A Lentivirus plasmid |
ORF Viral Vector | vGMLP003677 | Human HTR1A Lentivirus particle |
Target information
Target ID | GM-T78709 |
Target Name | HTR1A |
Gene ID | 3350, 15550, 694991, 24473, 101101542, 487230, 407137, 100009683 |
Gene Symbol and Synonyms | 5-HT-1A,5-HT1A,5HT1a,5htr1a,ADRB2RL1,ADRBRL1,G-21,Gpcr18,HTR1A,PFMCD,RAT5HT1A |
Uniprot Accession | P08908 |
Uniprot Entry Name | 5HT1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000178394 |
Target Classification | GPCR |
This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.