Human HTR1A/5-HT-1A/5-HT1A ORF/cDNA clone-Lentivirus particle (NM_000524)
Cat. No.: vGMLP003677
Pre-made Human HTR1A/5-HT-1A/5-HT1A Lentiviral expression plasmid for HTR1A lentivirus packaging, HTR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HTR1A/5-HT-1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003677 | Human HTR1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003677 |
| Gene Name | HTR1A |
| Accession Number | NM_000524 |
| Gene ID | 3350 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1269 bp |
| Gene Alias | 5-HT-1A,5-HT1A,5HT1a,ADRB2RL1,ADRBRL1,G-21,PFMCD |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGATGTGCTCAGCCCTGGTCAGGGCAACAACACCACATCACCACCGGCTCCCTTTGAGACCGGCGGCAACACTACTGGTATCTCCGACGTGACCGTCAGCTACCAAGTGATCACCTCTCTGCTGCTGGGCACGCTCATCTTCTGCGCGGTGCTGGGCAATGCGTGCGTGGTGGCTGCCATCGCCTTGGAGCGCTCCCTGCAGAACGTGGCCAATTATCTTATTGGCTCTTTGGCGGTCACCGACCTCATGGTGTCGGTGTTGGTGCTGCCCATGGCCGCGCTGTATCAGGTGCTCAACAAGTGGACACTGGGCCAGGTAACCTGCGACCTGTTCATCGCCCTCGACGTGCTGTGCTGCACCTCATCCATCTTGCACCTGTGCGCCATCGCGCTGGACAGGTACTGGGCCATCACGGACCCCATCGACTACGTGAACAAGAGGACGCCCCGGCGCGCCGCTGCGCTCATCTCGCTCACTTGGCTTATTGGCTTCCTCATCTCTATCCCGCCCATGCTGGGCTGGCGCACCCCGGAAGACCGCTCGGACCCCGACGCATGCACCATTAGCAAGGATCATGGCTACACTATCTATTCCACCTTTGGAGCTTTCTACATCCCGCTGCTGCTCATGCTGGTTCTCTATGGGCGCATATTCCGAGCTGCGCGCTTCCGCATCCGCAAGACGGTCAAAAAGGTGGAGAAGACCGGAGCGGACACCCGCCATGGAGCATCTCCCGCCCCGCAGCCCAAGAAGAGTGTGAATGGAGAGTCGGGGAGCAGGAACTGGAGGCTGGGCGTGGAGAGCAAGGCTGGGGGTGCTCTGTGCGCCAATGGCGCGGTGAGGCAAGGTGACGATGGCGCCGCCCTGGAGGTGATCGAGGTGCACCGAGTGGGCAACTCCAAAGAGCACTTGCCTCTGCCCAGCGAGGCTGGTCCTACCCCTTGTGCCCCCGCCTCTTTCGAGAGGAAAAATGAGCGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGCTGGGCATCATCATGGGCACCTTCATCCTCTGCTGGCTGCCCTTCTTCATCGTGGCTCTTGTTCTGCCCTTCTGCGAGAGCAGCTGCCACATGCCCACCCTGTTGGGCGCCATAATCAATTGGCTGGGCTACTCCAACTCTCTGCTTAACCCCGTCATTTACGCATACTTCAACAAGGACTTTCAAAACGCGTTTAAGAAGATCATTAAGTGTAAGTTCTGCCGCCAGTGA |
| ORF Protein Sequence | MDVLSPGQGNNTTSPPAPFETGGNTTGISDVTVSYQVITSLLLGTLIFCAVLGNACVVAAIALERSLQNVANYLIGSLAVTDLMVSVLVLPMAALYQVLNKWTLGQVTCDLFIALDVLCCTSSILHLCAIALDRYWAITDPIDYVNKRTPRRAAALISLTWLIGFLISIPPMLGWRTPEDRSDPDACTISKDHGYTIYSTFGAFYIPLLLMLVLYGRIFRAARFRIRKTVKKVEKTGADTRHGASPAPQPKKSVNGESGSRNWRLGVESKAGGALCANGAVRQGDDGAALEVIEVHRVGNSKEHLPLPSEAGPTPCAPASFERKNERNAEAKRKMALARERKTVKTLGIIMGTFILCWLPFFIVALVLPFCESSCHMPTLLGAIINWLGYSNSLLNPVIYAYFNKDFQNAFKKIIKCKFCRQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T78709-Ab | Anti-5HT1A/ HTR1A/ 5-HT-1A monoclonal antibody |
| Target Antigen | GM-Tg-g-T78709-Ag | HTR1A VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003677 | Human HTR1A Lentivirus plasmid |
| ORF Viral Vector | vGMLP003677 | Human HTR1A Lentivirus particle |
Target information
| Target ID | GM-T78709 |
| Target Name | HTR1A |
| Gene ID | 3350, 15550, 694991, 24473, 101101542, 487230, 407137, 100009683 |
| Gene Symbol and Synonyms | 5-HT-1A,5-HT1A,5HT1a,5htr1a,ADRB2RL1,ADRBRL1,G-21,Gpcr18,HTR1A,PFMCD,RAT5HT1A |
| Uniprot Accession | P08908 |
| Uniprot Entry Name | 5HT1A_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000178394 |
| Target Classification | GPCR |
This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


