Human GABRD/EIG10/ EJM7 ORF/cDNA clone-Lentivirus plasmid (NM_000815)

Pre-made Human GABRD/EIG10/ EJM7 Lentiviral expression plasmid for GABRD lentivirus packaging, GABRD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GABRD/EIG10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003715 Human GABRD Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003715
Gene Name GABRD
Accession Number NM_000815
Gene ID 2563
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1359 bp
Gene Alias EIG10, EJM7, GEFSP5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACGCGCCCGCCCGGCTGCTGGCCCCGCTCCTGCTCCTCTGCGCGCAGCAGCTCCGCGGCACCAGAGCGATGAATGACATCGGCGACTACGTGGGCTCCAACCTGGAGATCTCCTGGCTCCCCAACCTGGACGGGCTGATAGCCGGCTACGCCCGCAACTTCCGGCCTGGCATCGGAGGCCCCCCCGTGAATGTGGCCCTTGCCCTGGAGGTGGCCAGCATCGACCACATCTCAGAGGCCAACATGGAGTACACCATGACGGTGTTCCTGCACCAGAGCTGGCGGGACAGCAGGCTCTCCTACAACCACACCAACGAGACCCTGGGTCTGGACAGCCGCTTCGTGGACAAGCTGTGGCTGCCCGACACCTTCATCGTGAACGCCAAGTCGGCCTGGTTCCACGACGTGACGGTGGAGAACAAGCTCATCCGGCTGCAGCCCGACGGCGTGATCCTGTACAGCATCCGAATCACCTCCACTGTGGCCTGCGACATGGACCTGGCCAAATACCCCATGGACGAGCAGGAGTGCATGCTGGACCTGGAGAGCTACGGTTACTCATCGGAGGACATCGTCTACTACTGGTCGGAGAGCCAGGAGCACATCCACGGGCTGGACAAGCTGCAGCTGGCGCAGTTCACCATCACCAGCTACCGCTTCACCACGGAGCTGATGAACTTCAAGTCCGCTGGCCAGTTCCCACGGCTCAGCCTGCACTTCCACCTGCGGAGGAACCGCGGCGTGTACATCATCCAATCCTACATGCCCTCCGTCCTGCTGGTCGCCATGTCCTGGGTCTCCTTCTGGATCAGCCAGGCGGCGGTGCCCGCCAGGGTGTCTCTAGGCATCACCACGGTGCTGACGATGACCACGCTCATGGTCAGTGCCCGCTCCTCCCTGCCACGGGCATCAGCCATCAAGGCACTGGACGTCTACTTCTGGATCTGCTATGTCTTCGTGTTTGCCGCCCTGGTGGAGTACGCCTTTGCTCATTTCAACGCCGACTACAGGAAGAAGCAGAAGGCCAAGGTCAAGGTCTCCAGGCCGAGGGCAGAGATGGACGTGAGGAACGCCATTGTCCTCTTCTCCCTCTCTGCTGCCGGCGTCACGCAGGAGCTGGCCATCTCCCGCCGGCAGCGCCGCGTCCCGGGGAACCTGATGGGCTCCTACAGGTCGGTGGGGGTGGAGACAGGGGAGACGAAGAAGGAGGGGGCAGCCCGCTCAGGAGGCCAGGGGGGCATCCGTGCCCGGCTCAGGCCCATCGACGCAGACACCATTGACATTTACGCCCGCGCTGTGTTCCCTGCGGCGTTTGCGGCCGTCAATGTCATCTACTGGGCGGCATACGCCATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27376-Ab Anti-GBRD/ GABRD/ EIG10 monoclonal antibody
    Target Antigen GM-Tg-g-T27376-Ag GABRD VLP (virus-like particle)
    ORF Viral Vector pGMLV001902 Human GABRD Lentivirus plasmid
    ORF Viral Vector pGMLP003715 Human GABRD Lentivirus plasmid
    ORF Viral Vector pGMLP004093 Human GABRD Lentivirus plasmid
    ORF Viral Vector vGMLV001902 Human GABRD Lentivirus particle
    ORF Viral Vector vGMLP003715 Human GABRD Lentivirus particle
    ORF Viral Vector vGMLP004093 Human GABRD Lentivirus particle


    Target information

    Target ID GM-T27376
    Target Name GABRD
    Gene ID 2563, 14403, 710062, 29689, 101087589, 489609, 508711, 100064300
    Gene Symbol and Synonyms EIG10,EJM7,GABAA-RD,GABRD,GEFSP5
    Uniprot Accession O14764
    Uniprot Entry Name GBRD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000187730
    Target Classification Not Available

    Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.