Human GABRD/EIG10/ EJM7 ORF/cDNA clone-Lentivirus plasmid (NM_000815.5)
Pre-made Human GABRD/EIG10/ EJM7 Lentiviral expression plasmid for GABRD lentivirus packaging, GABRD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GABRD/EIG10 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001902 | Human GABRD Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001902 |
Gene Name | GABRD |
Accession Number | NM_000815.5 |
Gene ID | 2563 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1359 bp |
Gene Alias | EIG10, EJM7, GEFSP5 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACGCGCCCGCCCGGCTGCTGGCCCCGCTCCTGCTCCTCTGCGCGCAGCAGCTCCGCGGCACCAGAGCGATGAATGACATCGGCGACTACGTGGGCTCCAACCTGGAGATCTCCTGGCTCCCCAACCTGGACGGGCTGATAGCCGGCTACGCCCGCAACTTCCGGCCTGGCATCGGAGGCCCCCCCGTGAATGTGGCCCTTGCCCTGGAGGTGGCCAGCATCGACCACATCTCAGAGGCCAACATGGAGTACACCATGACGGTGTTCCTGCACCAGAGCTGGCGGGACAGCAGGCTCTCCTACAACCACACCAACGAGACCCTGGGTCTGGACAGCCGCTTCGTGGACAAGCTGTGGCTGCCCGACACCTTCATCGTGAACGCCAAGTCGGCCTGGTTCCACGACGTGACGGTGGAGAACAAGCTCATCCGGCTGCAGCCCGACGGCGTGATCCTGTACAGCATCCGAATCACCTCCACTGTGGCCTGCGACATGGACCTGGCCAAATACCCCATGGACGAGCAGGAGTGCATGCTGGACCTGGAGAGCTACGGTTACTCATCGGAGGACATCGTCTACTACTGGTCGGAGAGCCAGGAGCACATCCACGGGCTGGACAAGCTGCAGCTGGCGCAGTTCACCATCACCAGCTACCGCTTCACCACGGAGCTGATGAACTTCAAGTCCGCTGGCCAGTTCCCACGGCTCAGCCTGCACTTCCACCTGCGGAGGAACCGCGGCGTGTACATCATCCAATCCTACATGCCCTCCGTCCTGCTGGTCGCCATGTCCTGGGTCTCCTTCTGGATCAGCCAGGCGGCGGTGCCCGCCAGGGTGTCTCTAGGCATCACCACGGTGCTGACGATGACCACGCTCATGGTCAGTGCCCGCTCCTCCCTGCCACGGGCATCAGCCATCAAGGCACTGGACGTCTACTTCTGGATCTGCTATGTCTTCGTGTTTGCCGCCCTGGTGGAGTACGCCTTTGCTCATTTCAACGCCGACTACAGGAAGAAGCAGAAGGCCAAGGTCAAGGTCTCCAGGCCGAGGGCAGAGATGGACGTGAGGAACGCCATTGTCCTCTTCTCCCTCTCTGCTGCCGGCGTCACGCAGGAGCTGGCCATCTCCCGCCGGCAGCGCCGCGTCCCGGGGAACCTGATGGGCTCCTACAGGTCGGTGGGGGTGGAGACAGGGGAGACGAAGAAGGAGGGGGCAGCCCGCTCAGGAGGCCAGGGGGGCATCCGTGCCCGGCTCAGGCCCATCGACGCAGACACCATTGACATTTACGCCCGCGCTGTGTTCCCTGCGGCGTTTGCGGCCGTCAATGTCATCTACTGGGCGGCATACGCCATGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T27376-Ab | Anti-GBRD/ GABRD/ EIG10 monoclonal antibody |
Target Antigen | GM-Tg-g-T27376-Ag | GABRD VLP (virus-like particle) |
ORF Viral Vector | pGMLV001902 | Human GABRD Lentivirus plasmid |
ORF Viral Vector | pGMLP003715 | Human GABRD Lentivirus plasmid |
ORF Viral Vector | pGMLP004093 | Human GABRD Lentivirus plasmid |
ORF Viral Vector | vGMLV001902 | Human GABRD Lentivirus particle |
ORF Viral Vector | vGMLP003715 | Human GABRD Lentivirus particle |
ORF Viral Vector | vGMLP004093 | Human GABRD Lentivirus particle |
Target information
Target ID | GM-T27376 |
Target Name | GABRD |
Gene ID | 2563, 14403, 710062, 29689, 101087589, 489609, 508711, 100064300 |
Gene Symbol and Synonyms | EIG10,EJM7,GABAA-RD,GABRD,GEFSP5 |
Uniprot Accession | O14764 |
Uniprot Entry Name | GBRD_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000187730 |
Target Classification | Not Available |
Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.