Human CCR5/CC-CKR-5/ CCCKR5 ORF/cDNA clone-Lentivirus plasmid (NM_000579)

Pre-made Human CCR5/CC-CKR-5/ CCCKR5 Lentiviral expression plasmid for CCR5 lentivirus packaging, CCR5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CCR5/CC-CKR-5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003863 Human CCR5 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003863
Gene Name CCR5
Accession Number NM_000579
Gene ID 1234
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1059 bp
Gene Alias CC-CKR-5, CCCKR5, CCR-5, CD195, CKR-5, CKR5, CMKBR5, IDDM22
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-304 Pre-Made Leronlimab biosimilar, Whole mAb, Anti-CCR5 Antibody: Anti-CKR5/CCR-5/CD195/CKR-5/CCCKR5/CMKBR5/IDDM22/CC-CKR-5 therapeutic antibody
    Target Antibody GM-Tg-g-T09960-Ab Anti-CCR5/ CC-CKR-5/ CCCKR5 monoclonal antibody
    Target Antigen GM-Tg-g-T09960-Ag CCR5 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T09960 chemokine (C-C motif) receptor 5 (CCR5) protein & antibody
    ORF Viral Vector pGMLV001140 Human CCR5 Lentivirus plasmid
    ORF Viral Vector pGMLP003863 Human CCR5 Lentivirus plasmid
    ORF Viral Vector vGMLV001140 Human CCR5 Lentivirus particle
    ORF Viral Vector vGMLP003863 Human CCR5 Lentivirus particle


    Target information

    Target ID GM-T09960
    Target Name CCR5
    Gene ID 1234, 735311, 100048935
    Gene Symbol and Synonyms CC-CKR-5,CCCKR5,CCR-5,CCR5,CD195,CKR-5,CKR5,CMKBR5,IDDM22
    Uniprot Accession P51681
    Uniprot Entry Name CCR5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease HIV infection
    Gene Ensembl ENSG00000160791
    Target Classification Checkpoint-Immuno Oncology, GPCR

    This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.