Human COMT ORF/cDNA clone-Lentivirus plasmid (BC011935)
Pre-made Human COMT/ Lentiviral expression plasmid for COMT lentivirus packaging, COMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to COMT/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003872 | Human COMT Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003872 |
Gene Name | COMT |
Accession Number | BC011935 |
Gene ID | 1312 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 816 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCGGAGGCCCCGCCTCTGCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTGGTGCTGCTGCTGCTTCTGAGGCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAGTTCATCCTGCAGCCCATCCACAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTGAACCACGTGCTGCAGCATGCGGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGACACCTACTGCGAGCAGAAGGAGTGGGCCATGAACGTGGGCGACAAGAAAGGCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGGCCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTGATCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTGGCGTGAAGGACAAGGTCACCCTTGTGGTTGGAGCGTCCCAGGACATCATCCCCCAGCTGAAGAAGAAGTATGATGTGGACACACTGGACATGGTCTTCCTCGACCACTGGAAGGACCGGTACCTGCCGGACACGCTTCTCTTGGAGGAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGTGCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGAGTGCACACACTACCAATCGTTCCTGGAATACAGGGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCAGGCAGCGAAGCAGGGCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T76904-Ab | Anti-COMT/ HEL-S-98n monoclonal antibody |
Target Antigen | GM-Tg-g-T76904-Ag | COMT VLP (virus-like particle) |
ORF Viral Vector | pGMLP003872 | Human COMT Lentivirus plasmid |
ORF Viral Vector | pGMAP000020 | Human COMT Adenovirus plasmid |
ORF Viral Vector | pGMAP000064 | Human COMT Adenovirus plasmid |
ORF Viral Vector | vGMLP003872 | Human COMT Lentivirus particle |
ORF Viral Vector | vGMAP000020 | Human COMT Adenovirus particle |
ORF Viral Vector | vGMAP000064 | Human COMT Adenovirus particle |
Target information
Target ID | GM-T76904 |
Target Name | COMT |
Gene ID | 1312, 12846, 712548, 24267, 101097022, 445450, 618278 |
Gene Symbol and Synonyms | COMT,Comt1,D16Wsu103e,D330014B15Rik,HEL-S-98n |
Uniprot Accession | P21964 |
Uniprot Entry Name | COMT_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Malignant neoplasm of bladder, Schizophrenia |
Gene Ensembl | ENSG00000093010 |
Target Classification | Not Available |
Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.