Human COMT ORF/cDNA clone-Lentivirus particle (BC011935)

Pre-made Human COMT/ Lentiviral expression plasmid for COMT lentivirus packaging, COMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to COMT/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003872 Human COMT Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003872
Gene Name COMT
Accession Number BC011935
Gene ID 1312
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 816 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCGGAGGCCCCGCCTCTGCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTGGTGCTGCTGCTGCTTCTGAGGCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAGTTCATCCTGCAGCCCATCCACAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTGAACCACGTGCTGCAGCATGCGGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGACACCTACTGCGAGCAGAAGGAGTGGGCCATGAACGTGGGCGACAAGAAAGGCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGGCCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTGATCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTGGCGTGAAGGACAAGGTCACCCTTGTGGTTGGAGCGTCCCAGGACATCATCCCCCAGCTGAAGAAGAAGTATGATGTGGACACACTGGACATGGTCTTCCTCGACCACTGGAAGGACCGGTACCTGCCGGACACGCTTCTCTTGGAGGAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGTGCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGAGTGCACACACTACCAATCGTTCCTGGAATACAGGGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCAGGCAGCGAAGCAGGGCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T76904-Ab Anti-COMT/ HEL-S-98n monoclonal antibody
    Target Antigen GM-Tg-g-T76904-Ag COMT VLP (virus-like particle)
    ORF Viral Vector pGMLP003872 Human COMT Lentivirus plasmid
    ORF Viral Vector pGMAP000020 Human COMT Adenovirus plasmid
    ORF Viral Vector pGMAP000064 Human COMT Adenovirus plasmid
    ORF Viral Vector vGMLP003872 Human COMT Lentivirus particle
    ORF Viral Vector vGMAP000020 Human COMT Adenovirus particle
    ORF Viral Vector vGMAP000064 Human COMT Adenovirus particle


    Target information

    Target ID GM-T76904
    Target Name COMT
    Gene ID 1312, 12846, 712548, 24267, 101097022, 445450, 618278
    Gene Symbol and Synonyms COMT,Comt1,D16Wsu103e,D330014B15Rik,HEL-S-98n
    Uniprot Accession P21964
    Uniprot Entry Name COMT_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Malignant neoplasm of bladder, Schizophrenia
    Gene Ensembl ENSG00000093010
    Target Classification Not Available

    Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.