Human PROC/APC/PC ORF/cDNA clone-Lentivirus plasmid (NM_000312.3)
Cat. No.: pGMLP003902
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PROC/APC/PC Lentiviral expression plasmid for PROC lentivirus packaging, PROC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PROC/APC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP003902 |
Gene Name | PROC |
Accession Number | NM_000312.3 |
Gene ID | 5624 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1386 bp |
Gene Alias | APC,PC,PROC1,THPH3,THPH4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTGGCAGCTCACAAGCCTCCTGCTGTTCGTGGCCACCTGGGGAATTTCCGGCACACCAGCTCCTCTTGACTCAGTGTTCTCCAGCAGCGAGCGTGCCCACCAGGTGCTGCGGATCCGCAAACGTGCCAACTCCTTCCTGGAGGAGCTCCGTCACAGCAGCCTGGAGCGGGAGTGCATAGAGGAGATCTGTGACTTCGAGGAGGCCAAGGAAATTTTCCAAAATGTGGATGACACACTGGCCTTCTGGTCCAAGCACGTCGACGGTGACCAGTGCTTGGTCTTGCCCTTGGAGCACCCGTGCGCCAGCCTGTGCTGCGGGCACGGCACGTGCATCGACGGCATCGGCAGCTTCAGCTGCGACTGCCGCAGCGGCTGGGAGGGCCGCTTCTGCCAGCGCGAGGTGAGCTTCCTCAATTGCTCGCTGGACAACGGCGGCTGCACGCATTACTGCCTAGAGGAGGTGGGCTGGCGGCGCTGTAGCTGTGCGCCTGGCTACAAGCTGGGGGACGACCTCCTGCAGTGTCACCCCGCAGTGAAGTTCCCTTGTGGGAGGCCCTGGAAGCGGATGGAGAAGAAGCGCAGTCACCTGAAACGAGACACAGAAGACCAAGAAGACCAAGTAGATCCGCGGCTCATTGATGGGAAGATGACCAGGCGGGGAGACAGCCCCTGGCAGGTGGTCCTGCTGGACTCAAAGAAGAAGCTGGCCTGCGGGGCAGTGCTCATCCACCCCTCCTGGGTGCTGACAGCGGCCCACTGCATGGATGAGTCCAAGAAGCTCCTTGTCAGGCTTGGAGAGTATGACCTGCGGCGCTGGGAGAAGTGGGAGCTGGACCTGGACATCAAGGAGGTCTTCGTCCACCCCAACTACAGCAAGAGCACCACCGACAATGACATCGCACTGCTGCACCTGGCCCAGCCCGCCACCCTCTCGCAGACCATAGTGCCCATCTGCCTCCCGGACAGCGGCCTTGCAGAGCGCGAGCTCAATCAGGCCGGCCAGGAGACCCTCGTGACGGGCTGGGGCTACCACAGCAGCCGAGAGAAGGAGGCCAAGAGAAACCGCACCTTCGTCCTCAACTTCATCAAGATTCCCGTGGTCCCGCACAATGAGTGCAGCGAGGTCATGAGCAACATGGTGTCTGAGAACATGCTGTGTGCGGGCATCCTCGGGGACCGGCAGGATGCCTGCGAGGGCGACAGTGGGGGGCCCATGGTCGCCTCCTTCCACGGCACCTGGTTCCTGGTGGGCCTGGTGAGCTGGGGTGAGGGCTGTGGGCTCCTTCACAACTACGGCGTTTACACCAAAGTCAGCCGCTACCTCGACTGGATCCATGGGCACATCAGAGACAAGGAAGCCCCCCAGAAGAGCTGGGCACCTTAG |
ORF Protein Sequence | MWQLTSLLLFVATWGISGTPAPLDSVFSSSERAHQVLRIRKRANSFLEELRHSSLERECIEEICDFEEAKEIFQNVDDTLAFWSKHVDGDQCLVLPLEHPCASLCCGHGTCIDGIGSFSCDCRSGWEGRFCQREVSFLNCSLDNGGCTHYCLEEVGWRRCSCAPGYKLGDDLLQCHPAVKFPCGRPWKRMEKKRSHLKRDTEDQEDQVDPRLIDGKMTRRGDSPWQVVLLDSKKKLACGAVLIHPSWVLTAAHCMDESKKLLVRLGEYDLRRWEKWELDLDIKEVFVHPNYSKSTTDNDIALLHLAQPATLSQTIVPICLPDSGLAERELNQAGQETLVTGWGYHSSREKEAKRNRTFVLNFIKIPVVPHNECSEVMSNMVSENMLCAGILGDRQDACEGDSGGPMVASFHGTWFLVGLVSWGEGCGLLHNYGVYTKVSRYLDWIHGHIRDKEAPQKSWAP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T24836-Ab | Anti-PROC/ APC/ PC1 functional antibody |
Target Antigen | GM-Tg-g-T24836-Ag | PROC protein |
ORF Viral Vector | pGMLP002690 | Human PROC Lentivirus plasmid |
ORF Viral Vector | pGMLP003901 | Human PROC Lentivirus plasmid |
ORF Viral Vector | pGMLP003902 | Human PROC Lentivirus plasmid |
ORF Viral Vector | pGMLV000573 | Human PROC-mu Lentivirus plasmid |
ORF Viral Vector | pGMLV000878 | Human PROC Lentivirus plasmid |
ORF Viral Vector | vGMLP002690 | Human PROC Lentivirus particle |
ORF Viral Vector | vGMLP003901 | Human PROC Lentivirus particle |
ORF Viral Vector | vGMLP003902 | Human PROC Lentivirus particle |
ORF Viral Vector | vGMLV000573 | Human PROC-mu Lentivirus particle |
ORF Viral Vector | vGMLV000878 | Human PROC Lentivirus particle |
Target information
Target ID | GM-T24836 |
Target Name | PROC |
Gene ID | 5624, 19123, 699077, 25268, 101096161, 476104, 281428, 100051306 |
Gene Symbol and Synonyms | APC,PC,PROC,PROC1,THPH3,THPH4 |
Uniprot Accession | P04070 |
Uniprot Entry Name | PROC_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000115718 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a vitamin K-dependent plasma glycoprotein. The encoded protein is cleaved to its activated form by the thrombin-thrombomodulin complex. This activated form contains a serine protease domain and functions in degradation of the activated forms of coagulation factors V and VIII. Mutations in this gene have been associated with thrombophilia due to protein C deficiency, neonatal purpura fulminans, and recurrent venous thrombosis.[provided by RefSeq, Dec 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.