Human PROC/APC/PC ORF/cDNA clone-Lentivirus particle (NM_000312)

Cat. No.: vGMLP002690

Pre-made Human PROC/APC/PC Lentiviral expression plasmid for PROC lentivirus packaging, PROC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PROC/APC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002690 Human PROC Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002690
Gene Name PROC
Accession Number NM_000312
Gene ID 5624
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1386 bp
Gene Alias APC,PC,PROC1,THPH3,THPH4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCAGCTCACAAGCCTCCTGCTGTTCGTGGCCACCTGGGGAATTTCCGGCACACCAGCTCCTCTTGACTCAGTGTTCTCCAGCAGCGAGCGTGCCCACCAGGTGCTGCGGATCCGCAAACGTGCCAACTCCTTCCTGGAGGAGCTCCGTCACAGCAGCCTGGAGCGGGAGTGCATAGAGGAGATCTGTGACTTCGAGGAGGCCAAGGAAATTTTCCAAAATGTGGATGACACACTGGCCTTCTGGTCCAAGCACGTCGACGGTGACCAGTGCTTGGTCTTGCCCTTGGAGCACCCGTGCGCCAGCCTGTGCTGCGGGCACGGCACGTGCATCGACGGCATCGGCAGCTTCAGCTGCGACTGCCGCAGCGGCTGGGAGGGCCGCTTCTGCCAGCGCGAGGTGAGCTTCCTCAATTGCTCGCTGGACAACGGCGGCTGCACGCATTACTGCCTAGAGGAGGTGGGCTGGCGGCGCTGTAGCTGTGCGCCTGGCTACAAGCTGGGGGACGACCTCCTGCAGTGTCACCCCGCAGTGAAGTTCCCTTGTGGGAGGCCCTGGAAGCGGATGGAGAAGAAGCGCAGTCACCTGAAACGAGACACAGAAGACCAAGAAGACCAAGTAGATCCGCGGCTCATTGATGGGAAGATGACCAGGCGGGGAGACAGCCCCTGGCAGGTGGTCCTGCTGGACTCAAAGAAGAAGCTGGCCTGCGGGGCAGTGCTCATCCACCCCTCCTGGGTGCTGACAGCGGCCCACTGCATGGATGAGTCCAAGAAGCTCCTTGTCAGGCTTGGAGAGTATGACCTGCGGCGCTGGGAGAAGTGGGAGCTGGACCTGGACATCAAGGAGGTCTTCGTCCACCCCAACTACAGCAAGAGCACCACCGACAATGACATCGCACTGCTGCACCTGGCCCAGCCCGCCACCCTCTCGCAGACCATAGTGCCCATCTGCCTCCCGGACAGCGGCCTTGCAGAGCGCGAGCTCAATCAGGCCGGCCAGGAGACCCTCGTGACGGGCTGGGGCTACCACAGCAGCCGAGAGAAGGAGGCCAAGAGAAACCGCACCTTCGTCCTCAACTTCATCAAGATTCCCGTGGTCCCGCACAATGAGTGCAGCGAGGTCATGAGCAACATGGTGTCTGAGAACATGCTGTGTGCGGGCATCCTCGGGGACCGGCAGGATGCCTGCGAGGGCGACAGTGGGGGGCCCATGGTCGCCTCCTTCCACGGCACCTGGTTCCTGGTGGGCCTGGTGAGCTGGGGTGAGGGCTGTGGGCTCCTTCACAACTACGGCGTTTACACCAAAGTCAGCCGCTACCTCGACTGGATCCATGGGCACATCAGAGACAAGGAAGCCCCCCAGAAGAGCTGGGCACCTTAG
ORF Protein Sequence MWQLTSLLLFVATWGISGTPAPLDSVFSSSERAHQVLRIRKRANSFLEELRHSSLERECIEEICDFEEAKEIFQNVDDTLAFWSKHVDGDQCLVLPLEHPCASLCCGHGTCIDGIGSFSCDCRSGWEGRFCQREVSFLNCSLDNGGCTHYCLEEVGWRRCSCAPGYKLGDDLLQCHPAVKFPCGRPWKRMEKKRSHLKRDTEDQEDQVDPRLIDGKMTRRGDSPWQVVLLDSKKKLACGAVLIHPSWVLTAAHCMDESKKLLVRLGEYDLRRWEKWELDLDIKEVFVHPNYSKSTTDNDIALLHLAQPATLSQTIVPICLPDSGLAERELNQAGQETLVTGWGYHSSREKEAKRNRTFVLNFIKIPVVPHNECSEVMSNMVSENMLCAGILGDRQDACEGDSGGPMVASFHGTWFLVGLVSWGEGCGLLHNYGVYTKVSRYLDWIHGHIRDKEAPQKSWAP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24836-Ab Anti-PROC/ APC/ PC1 functional antibody
    Target Antigen GM-Tg-g-T24836-Ag PROC protein
    ORF Viral Vector pGMLP002690 Human PROC Lentivirus plasmid
    ORF Viral Vector pGMLP003901 Human PROC Lentivirus plasmid
    ORF Viral Vector pGMLP003902 Human PROC Lentivirus plasmid
    ORF Viral Vector pGMLV000573 Human PROC-mu Lentivirus plasmid
    ORF Viral Vector pGMLV000878 Human PROC Lentivirus plasmid
    ORF Viral Vector vGMLP002690 Human PROC Lentivirus particle
    ORF Viral Vector vGMLP003901 Human PROC Lentivirus particle
    ORF Viral Vector vGMLP003902 Human PROC Lentivirus particle
    ORF Viral Vector vGMLV000573 Human PROC-mu Lentivirus particle
    ORF Viral Vector vGMLV000878 Human PROC Lentivirus particle


    Target information

    Target ID GM-T24836
    Target Name PROC
    Gene ID 5624, 19123, 699077, 25268, 101096161, 476104, 281428, 100051306
    Gene Symbol and Synonyms APC,PC,PROC,PROC1,THPH3,THPH4
    Uniprot Accession P04070
    Uniprot Entry Name PROC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000115718
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a vitamin K-dependent plasma glycoprotein. The encoded protein is cleaved to its activated form by the thrombin-thrombomodulin complex. This activated form contains a serine protease domain and functions in degradation of the activated forms of coagulation factors V and VIII. Mutations in this gene have been associated with thrombophilia due to protein C deficiency, neonatal purpura fulminans, and recurrent venous thrombosis.[provided by RefSeq, Dec 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.