Human ACVR2A/ACTRII/ ACVR2 ORF/cDNA clone-Lentivirus plasmid (NM_001278579)

Pre-made Human ACVR2A/ACTRII/ ACVR2 Lentiviral expression plasmid for ACVR2A lentivirus packaging, ACVR2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ACVR2A/ACTRII products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004152 Human ACVR2A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004152
Gene Name ACVR2A
Accession Number NM_001278579
Gene ID 92
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1542 bp
Gene Alias ACTRII, ACVR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGAGCTGCTGCAAAGTTGGCGTTTGCCGTCTTTCTTATCTCCTGTTCTTCAGGTGCTATACTTGGTAGATCAGAAACTCAGGAGTGTCTTTTCTTTAATGCTAATTGGGAAAAAGACAGAACCAATCAAACTGGTGTTGAACCGTGTTATGGTGACAAAGATAAACGGCGGCATTGTTTTGCTACCTGGAAGAATATTTCTGGTTCCATTGAAATAGTGAAACAAGGTTGTTGGCTGGATGATATCAACTGCTATGACAGGACTGATTGTGTAGAAAAAAAAGACAGCCCTGAAGTATATTTTTGTTGCTGTGAGGGCAATATGTGTAATGAAAAGTTTTCTTATTTTCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCAGTTACACCTAAGCCACCCTATTACAACATCCTGCTCTATTCCTTGGTGCCACTTATGTTAATTGCGGGGATTGTCATTTGTGCATTTTGGGTGTACAGGCATCACAAGATGGCCTACCCTCCTGTACTTGTTCCAACTCAAGACCCAGGACCACCCCCACCTTCTCCATTACTAGGTTTGAAACCACTGCAGTTATTAGAAGTGAAAGCAAGGGGAAGATTTGGTTGTGTCTGGAAAGCCCAGTTGCTTAACGAATATGTGGCTGTCAAAATATTTCCAATACAGGACAAACAGTCATGGCAAAATGAATACGAAGTCTACAGTTTGCCTGGAATGAAGCATGAGAACATATTACAGTTCATTGGTGCAGAAAAACGAGGCACCAGTGTTGATGTGGATCTTTGGCTGATCACAGCATTTCATGAAAAGGGTTCACTATCAGACTTTCTTAAGGCTAATGTGGTCTCTTGGAATGAACTGTGTCATATTGCAGAAACCATGGCTAGAGGATTGGCATATTTACATGAGGATATACCTGGCCTAAAAGATGGCCACAAACCTGCCATATCTCACAGGGACATCAAAAGTAAAAATGTGCTGTTGAAAAACAACCTGACAGCTTGCATTGCTGACTTTGGGTTGGCCTTAAAATTTGAGGCTGGCAAGTCTGCAGGCGATACCCATGGACAGGTTGGTACCCGGAGGTACATGGCTCCAGAGGTATTAGAGGGTGCTATAAACTTCCAAAGGGATGCATTTTTGAGGATAGATATGTATGCCATGGGATTAGTCCTATGGGAACTGGCTTCTCGCTGTACTGCTGCAGATGGACCTGTAGATGAATACATGTTGCCATTTGAGGAGGAAATTGGCCAGCATCCATCTCTTGAAGACATGCAGGAAGTTGTTGTGCATAAAAAAAAGAGGCCTGTTTTAAGAGATTATTGGCAGAAACATGCTGGAATGGCAATGCTCTGTGAAACCATTGAAGAATGTTGGGATCACGACGCAGAAGCCAGGTTATCAGCTGGATGTGTAGGTGAAAGAATTACCCAGATGCAGAGACTAACAAATATTATTACCACAGAGGACATTGTAACAGTGGTCACAATGGTGACAAATGTTGACTTTCCTCCCAAAGAATCTAGTCTATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47366-Ab Anti-AVR2A/ ACVR2A/ ACTRII monoclonal antibody
    Target Antigen GM-Tg-g-T47366-Ag ACVR2A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T47366 activin A receptor, type IIA (ACVR2A) protein & antibody
    ORF Viral Vector pGMLP004152 Human ACVR2A Lentivirus plasmid
    ORF Viral Vector vGMLP004152 Human ACVR2A Lentivirus particle


    Target information

    Target ID GM-T47366
    Target Name ACVR2A
    Gene ID 92, 11480, 707017, 29263, 101097750, 476140, 281598, 100049823
    Gene Symbol and Synonyms ACTRII,ActrIIa,ACVR2,ACVR2A,rActR-II,TactrII
    Uniprot Accession P27037
    Uniprot Entry Name AVR2A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000121989
    Target Classification Kinase

    This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.