Human PTAFR/PAFR ORF/cDNA clone-Lentivirus plasmid (NM_000952)
Pre-made Human PTAFR/PAFR Lentiviral expression plasmid for PTAFR lentivirus packaging, PTAFR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PTAFR/PAFR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004334 | Human PTAFR Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004334 |
Gene Name | PTAFR |
Accession Number | NM_000952 |
Gene ID | 5724 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1029 bp |
Gene Alias | PAFR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCCACATGACTCCTCCCACATGGACTCTGAGTTCCGATACACTCTCTTCCCGATTGTTTACAGCATCATCTTTGTGCTCGGGGTCATTGCTAATGGCTACGTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGCAAGAAATTCAATGAGATAAAGATCTTCATGGTGAACCTCACCATGGCGGACATGCTCTTCTTGATCACCCTGCCACTTTGGATTGTCTACTACCAAAACCAGGGCAACTGGATACTCCCCAAATTCCTGTGCAACGTGGCTGGCTGCCTTTTCTTCATCAACACCTACTGCTCTGTGGCCTTCCTGGGCGTCATCACTTATAACCGCTTCCAGGCAGTAACTCGGCCCATCAAGACTGCTCAGGCCAACACCCGCAAGCGTGGCATCTCTTTGTCCTTGGTCATCTGGGTGGCCATTGTGGGAGCTGCATCCTACTTCCTCATCCTGGACTCCACCAACACAGTGCCCGACAGTGCTGGCTCAGGCAACGTCACTCGCTGCTTTGAGCATTACGAGAAGGGCAGCGTGCCAGTCCTCATCATCCACATCTTCATCGTGTTCAGCTTCTTCCTGGTCTTCCTCATCATCCTCTTCTGCAACCTGGTCATCATCCGTACCTTGCTCATGCAGCCGGTGCAGCAGCAGCGCAACGCTGAAGTCAAGCGCCGGGCGCTGTGGATGGTGTGCACGGTCTTGGCGGTGTTCATCATCTGCTTCGTGCCCCACCACGTGGTGCAGCTGCCCTGGACCCTTGCTGAGCTGGGCTTCCAGGACAGCAAATTCCACCAGGCCATTAATGATGCACATCAGGTCACCCTCTGCCTCCTTAGCACCAACTGTGTCTTAGACCCTGTTATCTACTGTTTCCTCACCAAGAAGTTCCGCAAGCACCTCACCGAAAAGTTCTACAGCATGCGCAGTAGCCGGAAATGCTCCCGGGCCACCACGGATACGGTCACTGAAGTGGTTGTGCCATTCAACCAGATCCCTGGCAATTCCCTCAAAAATTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T87023-Ab | Anti-PTAFR/ PAFR monoclonal antibody |
Target Antigen | GM-Tg-g-T87023-Ag | PTAFR VLP (virus-like particle) |
ORF Viral Vector | pGMLP004334 | Human PTAFR Lentivirus plasmid |
ORF Viral Vector | vGMLP004334 | Human PTAFR Lentivirus particle |
Target information
Target ID | GM-T87023 |
Target Name | PTAFR |
Gene ID | 5724, 19204, 716788, 58949, 101085906, 487336, 518283, 106780838 |
Gene Symbol and Synonyms | PAF-R,PAFR,PTAFR |
Uniprot Accession | P25105 |
Uniprot Entry Name | PTAFR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169403 |
Target Classification | GPCR |
This gene encodes a seven-transmembrane G-protein-coupled receptor for platelet-activating factor (PAF) that localizes to lipid rafts and/or caveolae in the cell membrane. PAF (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) is a phospholipid that plays a significant role in oncogenic transformation, tumor growth, angiogenesis, metastasis, and pro-inflammatory processes. Binding of PAF to the PAF-receptor (PAFR) stimulates numerous signal transduction pathways including phospholipase C, D, A2, mitogen-activated protein kinases (MAPKs), and the phosphatidylinositol-calcium second messenger system. Following PAFR activation, cells become rapidly desensitized and this refractory state is dependent on PAFR phosphorylation, internalization, and down-regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.