Human PTAFR/PAFR ORF/cDNA clone-Lentivirus particle (NM_000952)

Pre-made Human PTAFR/PAFR Lentiviral expression plasmid for PTAFR lentivirus packaging, PTAFR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PTAFR/PAFR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004334 Human PTAFR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004334
Gene Name PTAFR
Accession Number NM_000952
Gene ID 5724
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1029 bp
Gene Alias PAFR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCCACATGACTCCTCCCACATGGACTCTGAGTTCCGATACACTCTCTTCCCGATTGTTTACAGCATCATCTTTGTGCTCGGGGTCATTGCTAATGGCTACGTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGCAAGAAATTCAATGAGATAAAGATCTTCATGGTGAACCTCACCATGGCGGACATGCTCTTCTTGATCACCCTGCCACTTTGGATTGTCTACTACCAAAACCAGGGCAACTGGATACTCCCCAAATTCCTGTGCAACGTGGCTGGCTGCCTTTTCTTCATCAACACCTACTGCTCTGTGGCCTTCCTGGGCGTCATCACTTATAACCGCTTCCAGGCAGTAACTCGGCCCATCAAGACTGCTCAGGCCAACACCCGCAAGCGTGGCATCTCTTTGTCCTTGGTCATCTGGGTGGCCATTGTGGGAGCTGCATCCTACTTCCTCATCCTGGACTCCACCAACACAGTGCCCGACAGTGCTGGCTCAGGCAACGTCACTCGCTGCTTTGAGCATTACGAGAAGGGCAGCGTGCCAGTCCTCATCATCCACATCTTCATCGTGTTCAGCTTCTTCCTGGTCTTCCTCATCATCCTCTTCTGCAACCTGGTCATCATCCGTACCTTGCTCATGCAGCCGGTGCAGCAGCAGCGCAACGCTGAAGTCAAGCGCCGGGCGCTGTGGATGGTGTGCACGGTCTTGGCGGTGTTCATCATCTGCTTCGTGCCCCACCACGTGGTGCAGCTGCCCTGGACCCTTGCTGAGCTGGGCTTCCAGGACAGCAAATTCCACCAGGCCATTAATGATGCACATCAGGTCACCCTCTGCCTCCTTAGCACCAACTGTGTCTTAGACCCTGTTATCTACTGTTTCCTCACCAAGAAGTTCCGCAAGCACCTCACCGAAAAGTTCTACAGCATGCGCAGTAGCCGGAAATGCTCCCGGGCCACCACGGATACGGTCACTGAAGTGGTTGTGCCATTCAACCAGATCCCTGGCAATTCCCTCAAAAATTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T87023-Ab Anti-PTAFR/ PAFR monoclonal antibody
    Target Antigen GM-Tg-g-T87023-Ag PTAFR VLP (virus-like particle)
    ORF Viral Vector pGMLP004334 Human PTAFR Lentivirus plasmid
    ORF Viral Vector vGMLP004334 Human PTAFR Lentivirus particle


    Target information

    Target ID GM-T87023
    Target Name PTAFR
    Gene ID 5724, 19204, 716788, 58949, 101085906, 487336, 518283, 106780838
    Gene Symbol and Synonyms PAF-R,PAFR,PTAFR
    Uniprot Accession P25105
    Uniprot Entry Name PTAFR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169403
    Target Classification GPCR

    This gene encodes a seven-transmembrane G-protein-coupled receptor for platelet-activating factor (PAF) that localizes to lipid rafts and/or caveolae in the cell membrane. PAF (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) is a phospholipid that plays a significant role in oncogenic transformation, tumor growth, angiogenesis, metastasis, and pro-inflammatory processes. Binding of PAF to the PAF-receptor (PAFR) stimulates numerous signal transduction pathways including phospholipase C, D, A2, mitogen-activated protein kinases (MAPKs), and the phosphatidylinositol-calcium second messenger system. Following PAFR activation, cells become rapidly desensitized and this refractory state is dependent on PAFR phosphorylation, internalization, and down-regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.