Human ADCYAP1/PACAP ORF/cDNA clone-Lentivirus plasmid (NM_001117)
Pre-made Human ADCYAP1/PACAP Lentiviral expression plasmid for ADCYAP1 lentivirus packaging, ADCYAP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PACAP-38/ADCYAP1/PACAP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004453 | Human ADCYAP1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004453 |
Gene Name | ADCYAP1 |
Accession Number | NM_001117 |
Gene ID | 116 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 531 bp |
Gene Alias | PACAP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCATGTGTAGCGGAGCGAGGCTGGCCCTGCTGGTCTATGGGATAATCATGCACAGCAGCGTCTACAGCTCACCTGCCGCCGCCGGACTCCGGTTCCCCGGGATCAGGCCAGAGGAAGAGGCGTACGGCGAGGACGGAAACCCGCTGCCAGACTTCGATGGCTCGGAGCCGCCGGGCGCAGGGAGCCCCGCCTCCGCGCCGCGCGCCGCCGCCGCCTGGTACCGCCCGGCCGGGAGAAGAGATGTCGCCCACGGGATCCTTAACGAGGCCTACCGCAAAGTGCTGGACCAGCTGTCCGCCGGGAAGCACCTGCAGTCGCTCGTGGCCCGGGGCGTGGGTGGGAGCCTCGGCGGCGGCGCGGGGGACGACGCGGAGCCGCTCTCCAAGCGCCACTCGGACGGGATCTTCACGGACAGCTACAGCCGCTACCGGAAACAAATGGCTGTCAAGAAATACTTGGCGGCCGTCCTAGGGAAGAGGTATAAACAAAGGGTTAAAAACAAAGGACGCCGAATAGCTTATTTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T07045-Ab | Anti-PACA/ PACAP-38/ ADCYAP1 functional antibody |
Target Antigen | GM-Tg-g-T07045-Ag | PACAP-38/ADCYAP1 protein |
ORF Viral Vector | pGMAAV000069 | Rat Adcyap1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000317 | Human ADCYAP1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP004453 | Human ADCYAP1 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000069 | Rat Adcyap1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000317 | Human ADCYAP1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP004453 | Human ADCYAP1 Lentivirus particle |
Target information
Target ID | GM-T07045 |
Target Name | PACAP-38 |
Gene ID | 116, 11516, 100424113, 24166, 101090471, 607433, 615187, 100061356 |
Gene Symbol and Synonyms | ADCYAP1,PACAP |
Uniprot Accession | P18509 |
Uniprot Entry Name | PACA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000141433 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a secreted proprotein that is further processed into multiple mature peptides. These peptides stimulate adenylate cyclase and increase cyclic adenosine monophosphate (cAMP) levels, resulting in the transcriptional activation of target genes. The products of this gene are key mediators of neuroendocrine stress responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.