Human ADCYAP1/PACAP ORF/cDNA clone-Lentivirus plasmid (NM_001117)

Pre-made Human ADCYAP1/PACAP Lentiviral expression plasmid for ADCYAP1 lentivirus packaging, ADCYAP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PACAP-38/ADCYAP1/PACAP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004453 Human ADCYAP1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004453
Gene Name ADCYAP1
Accession Number NM_001117
Gene ID 116
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 531 bp
Gene Alias PACAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGTGTAGCGGAGCGAGGCTGGCCCTGCTGGTCTATGGGATAATCATGCACAGCAGCGTCTACAGCTCACCTGCCGCCGCCGGACTCCGGTTCCCCGGGATCAGGCCAGAGGAAGAGGCGTACGGCGAGGACGGAAACCCGCTGCCAGACTTCGATGGCTCGGAGCCGCCGGGCGCAGGGAGCCCCGCCTCCGCGCCGCGCGCCGCCGCCGCCTGGTACCGCCCGGCCGGGAGAAGAGATGTCGCCCACGGGATCCTTAACGAGGCCTACCGCAAAGTGCTGGACCAGCTGTCCGCCGGGAAGCACCTGCAGTCGCTCGTGGCCCGGGGCGTGGGTGGGAGCCTCGGCGGCGGCGCGGGGGACGACGCGGAGCCGCTCTCCAAGCGCCACTCGGACGGGATCTTCACGGACAGCTACAGCCGCTACCGGAAACAAATGGCTGTCAAGAAATACTTGGCGGCCGTCCTAGGGAAGAGGTATAAACAAAGGGTTAAAAACAAAGGACGCCGAATAGCTTATTTGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T07045-Ab Anti-PACA/ PACAP-38/ ADCYAP1 functional antibody
    Target Antigen GM-Tg-g-T07045-Ag PACAP-38/ADCYAP1 protein
    ORF Viral Vector pGMAAV000069 Rat Adcyap1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000317 Human ADCYAP1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP004453 Human ADCYAP1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000069 Rat Adcyap1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000317 Human ADCYAP1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004453 Human ADCYAP1 Lentivirus particle


    Target information

    Target ID GM-T07045
    Target Name PACAP-38
    Gene ID 116, 11516, 100424113, 24166, 101090471, 607433, 615187, 100061356
    Gene Symbol and Synonyms ADCYAP1,PACAP
    Uniprot Accession P18509
    Uniprot Entry Name PACA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000141433
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a secreted proprotein that is further processed into multiple mature peptides. These peptides stimulate adenylate cyclase and increase cyclic adenosine monophosphate (cAMP) levels, resulting in the transcriptional activation of target genes. The products of this gene are key mediators of neuroendocrine stress responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.