Human IL5/EDF/ IL-5 ORF/cDNA clone-Lentivirus plasmid (NM_000879)

Pre-made Human IL5/EDF/ IL-5 Lentiviral expression plasmid for IL5 lentivirus packaging, IL5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IL5/EDF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004769 Human IL5 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004769
Gene Name IL5
Accession Number NM_000879
Gene ID 3567
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 405 bp
Gene Alias EDF, IL-5, TRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTGGAGCTGCCTACGTGTATGCCATCCCCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTCCTGTTCCTGTACATAAAAATCACCAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCACACTGGAGAGTCAAACTGTGCAAGGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCTTAATAAAGAAATACATTGACGGCCAAAAAAAAAAGTGTGGAGAAGAAAGACGGAGAGTAAACCAATTCCTAGACTACCTGCAAGAGTTTCTTGGTGTAATGAACACCGAGTGGATAATAGAAAGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-479 Pre-Made Reslizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Biosimilar GMP-Bios-ab-142 Pre-Made Depemokimab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Biosimilar GMP-Bios-ab-341 Pre-Made Mepolizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody
    Target Antibody GM-Tg-g-T78585-Ab Anti-IL5/ EDF/ IL-5 functional antibody
    Target Antigen GM-Tg-g-T78585-Ag IL5 protein
    ORF Viral Vector pGMLP004769 Human IL5 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-008 Human IL5 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-091 Human IL5 Adenovirus plasmid
    ORF Viral Vector vGMLP004769 Human IL5 Lentivirus particle
    ORF Viral Vector vGMLP-IL-008 Human IL5 Lentivirus particle
    ORF Viral Vector vGMAP-IL-091 Human IL5 Adenovirus particle


    Target information

    Target ID GM-T78585
    Target Name IL5
    Gene ID 3567, 16191, 710622, 24497, 493803, 403790, 280825, 100034199
    Gene Symbol and Synonyms EDF,IL-5,IL5,TRF
    Uniprot Accession P05113
    Uniprot Entry Name IL5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Hodgkin's disease, Overactive bladder
    Gene Ensembl ENSG00000113525
    Target Classification Not Available

    This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.