Human IL5/EDF/ IL-5 ORF/cDNA clone-Adenovirus particle (NM_000879)
Pre-made Human IL5/EDF/ IL-5 Adenovirus for IL5 overexpression in-vitro and in-vivo. The IL5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to IL5/EDF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP-IL-091 | Human IL5 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP-IL-091 |
Gene Name | IL5 |
Accession Number | NM_000879 |
Gene ID | 3567 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 405 bp |
Gene Alias | EDF, IL-5, TRF |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGATGCTTCTGCATTTGAGTTTGCTAGCTCTTGGAGCTGCCTACGTGTATGCCATCCCCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTCCTGTTCCTGTACATAAAAATCACCAACTGTGCACTGAAGAAATCTTTCAGGGAATAGGCACACTGGAGAGTCAAACTGTGCAAGGGGGTACTGTGGAAAGACTATTCAAAAACTTGTCCTTAATAAAGAAATACATTGACGGCCAAAAAAAAAAGTGTGGAGAAGAAAGACGGAGAGTAAACCAATTCCTAGACTACCTGCAAGAGTTTCTTGGTGTAATGAACACCGAGTGGATAATAGAAAGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-479 | Pre-Made Reslizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody |
Biosimilar | GMP-Bios-ab-142 | Pre-Made Depemokimab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody |
Biosimilar | GMP-Bios-ab-341 | Pre-Made Mepolizumab biosimilar, Whole mAb, Anti-IL5 Antibody: Anti-EDF/IL-5/TRF therapeutic antibody |
Target Antibody | GM-Tg-g-T78585-Ab | Anti-IL5/ EDF/ IL-5 functional antibody |
Target Antigen | GM-Tg-g-T78585-Ag | IL5 protein |
ORF Viral Vector | pGMLP004769 | Human IL5 Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-008 | Human IL5 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-091 | Human IL5 Adenovirus plasmid |
ORF Viral Vector | vGMLP004769 | Human IL5 Lentivirus particle |
ORF Viral Vector | vGMLP-IL-008 | Human IL5 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-091 | Human IL5 Adenovirus particle |
Target information
Target ID | GM-T78585 |
Target Name | IL5 |
Gene ID | 3567, 16191, 710622, 24497, 493803, 403790, 280825, 100034199 |
Gene Symbol and Synonyms | EDF,IL-5,IL5,TRF |
Uniprot Accession | P05113 |
Uniprot Entry Name | IL5_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index |
Disease | Hodgkin's disease, Overactive bladder |
Gene Ensembl | ENSG00000113525 |
Target Classification | Not Available |
This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.