Human CD52/CDW52/ EDDM5 ORF/cDNA clone-Lentivirus plasmid (NM_001803)
Pre-made Human CD52/CDW52/ EDDM5 Lentiviral expression plasmid for CD52 lentivirus packaging, CD52 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CD52/CDW52 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004985 | Human CD52 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004985 |
Gene Name | CD52 |
Accession Number | NM_001803 |
Gene ID | 1043 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 186 bp |
Gene Alias | CDW52, EDDM5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGCGCTTCCTCTTCCTCCTACTCACCATCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAAACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAACATAAGCGGAGGCATTTTCCTTTTCTTCGTGGCCAATGCCATAATCCACCTCTTCTGCTTCAGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-015 | Pre-Made Alemtuzumab biosimilar, Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody |
Biosimilar | GMP-Bios-ab-237 | Pre-Made Gatralimab biosimilar, Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody |
Biosimilar | GMP-Bios-ab-548 | Pre-Made Tamtuvetmab biosimilar, Canine Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody |
Target Antibody | GM-Tg-g-T76630-Ab | Anti-CD52/ CDW52/ EDDM5 monoclonal antibody |
Target Antigen | GM-Tg-g-T76630-Ag | CD52 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004985 | Human CD52 Lentivirus plasmid |
ORF Viral Vector | vGMLP004985 | Human CD52 Lentivirus particle |
Target information
Target ID | GM-T76630 |
Target Name | CD52 |
Gene ID | 1043, 23833, 714429, 117054, 101085645, 403918, 507141, 111772400 |
Gene Symbol and Synonyms | B7,B7-Ag,CAMPATH-1,CD52,CDW52,CE5,CLS1,EDDM5,HE5,MB7 |
Uniprot Accession | P31358 |
Uniprot Entry Name | CD52_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000169442 |
Target Classification | Checkpoint-Immuno Oncology |
Involved in positive regulation of cytosolic calcium ion concentration. Predicted to be located in extracellular region and plasma membrane. Predicted to be intrinsic component of plasma membrane. Predicted to be active in sperm midpiece. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.