Human CD52/CDW52/ EDDM5 ORF/cDNA clone-Lentivirus plasmid (NM_001803)

Pre-made Human CD52/CDW52/ EDDM5 Lentiviral expression plasmid for CD52 lentivirus packaging, CD52 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CD52/CDW52 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004985 Human CD52 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004985
Gene Name CD52
Accession Number NM_001803
Gene ID 1043
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 186 bp
Gene Alias CDW52, EDDM5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCGCTTCCTCTTCCTCCTACTCACCATCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAAACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAACATAAGCGGAGGCATTTTCCTTTTCTTCGTGGCCAATGCCATAATCCACCTCTTCTGCTTCAGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-015 Pre-Made Alemtuzumab biosimilar, Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody
    Biosimilar GMP-Bios-ab-237 Pre-Made Gatralimab biosimilar, Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody
    Biosimilar GMP-Bios-ab-548 Pre-Made Tamtuvetmab biosimilar, Canine Whole mAb, Anti-CD52 Antibody: Anti-HE5/CDW52/EDDM5 therapeutic antibody
    Target Antibody GM-Tg-g-T76630-Ab Anti-CD52/ CDW52/ EDDM5 monoclonal antibody
    Target Antigen GM-Tg-g-T76630-Ag CD52 VLP (virus-like particle)
    ORF Viral Vector pGMLP004985 Human CD52 Lentivirus plasmid
    ORF Viral Vector vGMLP004985 Human CD52 Lentivirus particle


    Target information

    Target ID GM-T76630
    Target Name CD52
    Gene ID 1043, 23833, 714429, 117054, 101085645, 403918, 507141, 111772400
    Gene Symbol and Synonyms B7,B7-Ag,CAMPATH-1,CD52,CDW52,CE5,CLS1,EDDM5,HE5,MB7
    Uniprot Accession P31358
    Uniprot Entry Name CD52_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000169442
    Target Classification Checkpoint-Immuno Oncology

    Involved in positive regulation of cytosolic calcium ion concentration. Predicted to be located in extracellular region and plasma membrane. Predicted to be intrinsic component of plasma membrane. Predicted to be active in sperm midpiece. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.