Human UPK3B/P35/UP3B ORF/cDNA clone-Lentivirus plasmid (NM_030570)

Cat. No.: pGMLP005058
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UPK3B/P35/UP3B Lentiviral expression plasmid for UPK3B lentivirus packaging, UPK3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to UPK3B/P35 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $540.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005058
Gene Name UPK3B
Accession Number NM_030570
Gene ID 105375355
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 963 bp
Gene Alias P35,UP3B,UPIIIB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCTACCCTGGGGGCAGCCTCACCTAGGGCTGCAGATGCTCCTCCTGGCATTGAACTGTCTCCGGCCCAGCCTGAGCCTGGGTGAGTGGGGGTCCTGGATGGACGCGTCCAGCCAGACCCAAGGGGCTGGGGGCCCTGCTGGAGTGATTGGACCCTGGGCGCCCGCCCCCCTCCGATTGGGAGAGGCAGCCCCAGGGACCCCCACGCCCGTCTCCGTGGCTCACCTTTTGTCCCCCGTGGCCACAGAGCTGGTGCCCTACACACCACAGATAACAGCTTGGGACCTGGAAGGGAAGGTCACAGCCACCACCTTCTCCCTGGAGCAGCCGCGCTGTGTCTTCGATGGGCTTGCCAGCGCCAGCGATACCGTCTGGCTCGTGGTGGCCTTCAGCAATGCCTCCAGGGGCTTCCAGAACCCGGAGACACTGGCTGACATTCCGGCCTCCCCACAGCTGCTGACCGATGGCCACTACATGACGCTGCCCCTGTCTCCGGACCAGCTGCCCTGTGGCGACCCCATGGCGGGCAGCGGAGGCGCCCCCGTGCTGCGGGTGGGCCATGACCACGGCTGCCACCAGCAGCCCTTCTGCAACGCGCCCCTCCCTGGCCCTGGACCCTATCGGGAAGACCCCCGGATCCATCGACACCTGGCCAGGGCGGCGAAGTGGCAGCATGATCGTCATTACCTCCATCCTCTCTTCTCTGGCCGGCCTCCTACTCTTGGCCTTCTTGGCAGCCTCTACCATGCGCTTCTCCAGCCTGTGGTGGCCGGAGGAGGCCCCGGAGCAGCTGCGGATCGGCTCCTTCATGGGCAAGCGCTACATGACCCACCACATCCCACCCAGCGAGGCCGCCACACTGCCGGTGGGCTGCAAGCCTGGCCTGGACCCCCTCCCCAGCCTCAGCCCCTAGCCTGGCCTCTTTGCATGGGGCTGGGGGAGATGGGGCGCCGGGAGTGA
ORF Protein Sequence MGLPWGQPHLGLQMLLLALNCLRPSLSLGEWGSWMDASSQTQGAGGPAGVIGPWAPAPLRLGEAAPGTPTPVSVAHLLSPVATELVPYTPQITAWDLEGKVTATTFSLEQPRCVFDGLASASDTVWLVVAFSNASRGFQNPETLADIPASPQLLTDGHYMTLPLSPDQLPCGDPMAGSGGAPVLRVGHDHGCHQQPFCNAPLPGPGPYREDPRIHRHLARAAKWQHDRHYLHPLFSGRPPTLGLLGSLYHALLQPVVAGGGPGAAADRLLHGQALHDPPHPTQRGRHTAGGLQAWPGPPPQPQPLAWPLCMGLGEMGRRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1909-Ab Anti-UPK3B/ P35/ UP3B monoclonal antibody
    Target Antigen GM-Tg-g-MP1909-Ag UPK3B VLP (virus-like particle)
    ORF Viral Vector pGMLP005058 Human UPK3B Lentivirus plasmid
    ORF Viral Vector vGMLP005058 Human UPK3B Lentivirus particle


    Target information

    Target ID GM-MP1909
    Target Name UPK3B
    Gene ID 105375355, 100647, 715377, 360790, 101083641, 607577, 282115, 100060861
    Gene Symbol and Synonyms P35,PMS2L14,RGD1309615,UP3B,UPIIIB,UPK3B
    Uniprot Accession Q9BT76
    Uniprot Entry Name UPK3B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000243566
    Target Classification Not Available

    UPK3B is a minor component of the apical plaques of mammalian urothelium that binds and dimerizes with uroplakin-1b (UPK1B; MIM 602380), one of the major conserved urothelium membrane proteins. The other major conserved integral membrane proteins of urothelial plaques are UPK1A (MIM 611557), UPK2 (MIM 611558), and UPK3A (MIM 611559) (Deng et al., 2002 [PubMed 12446744]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.