Human UPK3B/P35/UP3B ORF/cDNA clone-Lentivirus particle (NM_030570)
Cat. No.: vGMLP005058
Pre-made Human UPK3B/P35/UP3B Lentiviral expression plasmid for UPK3B lentivirus packaging, UPK3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
UPK3B/P35 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP005058 | Human UPK3B Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP005058 |
| Gene Name | UPK3B |
| Accession Number | NM_030570 |
| Gene ID | 105375355 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 963 bp |
| Gene Alias | P35,UP3B,UPIIIB |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGGCTACCCTGGGGGCAGCCTCACCTAGGGCTGCAGATGCTCCTCCTGGCATTGAACTGTCTCCGGCCCAGCCTGAGCCTGGGTGAGTGGGGGTCCTGGATGGACGCGTCCAGCCAGACCCAAGGGGCTGGGGGCCCTGCTGGAGTGATTGGACCCTGGGCGCCCGCCCCCCTCCGATTGGGAGAGGCAGCCCCAGGGACCCCCACGCCCGTCTCCGTGGCTCACCTTTTGTCCCCCGTGGCCACAGAGCTGGTGCCCTACACACCACAGATAACAGCTTGGGACCTGGAAGGGAAGGTCACAGCCACCACCTTCTCCCTGGAGCAGCCGCGCTGTGTCTTCGATGGGCTTGCCAGCGCCAGCGATACCGTCTGGCTCGTGGTGGCCTTCAGCAATGCCTCCAGGGGCTTCCAGAACCCGGAGACACTGGCTGACATTCCGGCCTCCCCACAGCTGCTGACCGATGGCCACTACATGACGCTGCCCCTGTCTCCGGACCAGCTGCCCTGTGGCGACCCCATGGCGGGCAGCGGAGGCGCCCCCGTGCTGCGGGTGGGCCATGACCACGGCTGCCACCAGCAGCCCTTCTGCAACGCGCCCCTCCCTGGCCCTGGACCCTATCGGGAAGACCCCCGGATCCATCGACACCTGGCCAGGGCGGCGAAGTGGCAGCATGATCGTCATTACCTCCATCCTCTCTTCTCTGGCCGGCCTCCTACTCTTGGCCTTCTTGGCAGCCTCTACCATGCGCTTCTCCAGCCTGTGGTGGCCGGAGGAGGCCCCGGAGCAGCTGCGGATCGGCTCCTTCATGGGCAAGCGCTACATGACCCACCACATCCCACCCAGCGAGGCCGCCACACTGCCGGTGGGCTGCAAGCCTGGCCTGGACCCCCTCCCCAGCCTCAGCCCCTAGCCTGGCCTCTTTGCATGGGGCTGGGGGAGATGGGGCGCCGGGAGTGA |
| ORF Protein Sequence | MGLPWGQPHLGLQMLLLALNCLRPSLSLGEWGSWMDASSQTQGAGGPAGVIGPWAPAPLRLGEAAPGTPTPVSVAHLLSPVATELVPYTPQITAWDLEGKVTATTFSLEQPRCVFDGLASASDTVWLVVAFSNASRGFQNPETLADIPASPQLLTDGHYMTLPLSPDQLPCGDPMAGSGGAPVLRVGHDHGCHQQPFCNAPLPGPGPYREDPRIHRHLARAAKWQHDRHYLHPLFSGRPPTLGLLGSLYHALLQPVVAGGGPGAAADRLLHGQALHDPPHPTQRGRHTAGGLQAWPGPPPQPQPLAWPLCMGLGEMGRRE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP1909-Ab | Anti-UPK3B/ P35/ UP3B monoclonal antibody |
| Target Antigen | GM-Tg-g-MP1909-Ag | UPK3B VLP (virus-like particle) |
| ORF Viral Vector | pGMLP005058 | Human UPK3B Lentivirus plasmid |
| ORF Viral Vector | vGMLP005058 | Human UPK3B Lentivirus particle |
Target information
| Target ID | GM-MP1909 |
| Target Name | UPK3B |
| Gene ID | 105375355, 100647, 715377, 360790, 101083641, 607577, 282115, 100060861 |
| Gene Symbol and Synonyms | P35,PMS2L14,RGD1309615,UP3B,UPIIIB,UPK3B |
| Uniprot Accession | Q9BT76 |
| Uniprot Entry Name | UPK3B_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000243566 |
| Target Classification | Not Available |
UPK3B is a minor component of the apical plaques of mammalian urothelium that binds and dimerizes with uroplakin-1b (UPK1B; MIM 602380), one of the major conserved urothelium membrane proteins. The other major conserved integral membrane proteins of urothelial plaques are UPK1A (MIM 611557), UPK2 (MIM 611558), and UPK3A (MIM 611559) (Deng et al., 2002 [PubMed 12446744]).[supplied by OMIM, Mar 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


