Human TES/TESS/ TESS-2 ORF/cDNA clone-Lentivirus plasmid (NM_015641)

Pre-made Human TES/TESS/ TESS-2 Lentiviral expression plasmid for TES lentivirus packaging, TES lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TES/TESS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005111 Human TES Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005111
Gene Name TES
Accession Number NM_015641
Gene ID 26136
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1266 bp
Gene Alias TESS, TESS-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCTGGAAAACAAAGTGAAGAAGATGGGCTTAGGTCACGAGCAAGGATTTGGAGCCCCTTGTTTAAAATGCAAAGAAAAATGTGAAGGATTCGAACTGCACTTCTGGAGAAAAATATGTCGTAACTGCAAGTGTGGCCAAGAAGAGCATGATGTCCTCTTGAGCAATGAAGAGGATCGAAAAGTGGGAAAACTTTTTGAAGACACCAAGTATACCACTCTGATTGCAAAACTAAAGTCAGATGGAATTCCCATGTATAAACGCAATGTTATGATATTGACGAATCCAGTTGCTGCCAAGAAGAATGTCTCCATCAATACAGTTACCTATGAGTGGGCTCCTCCTGTCCAGAATCAAGCATTGGCCAGGCAGTACATGCAGATGCTACCCAAGGAAAAGCAGCCAGTAGCAGGCTCAGAGGGGGCACAGTACCGGAAGAAGCAGCTGGCAAAGCAGCTCCCTGCACATGACCAGGACCCTTCAAAGTGCCATGAGTTGTCTCCCAGAGAGGTGAAGGAGATGGAGCAGTTTGTGAAGAAATATAAGAGCGAAGCTCTGGGAGTAGGAGATGTCAAACTTCCCTGTGAGATGGATGCCCAAGGCCCCAAACAAATGAACATTCCTGGAGGGGATAGAAGCACCCCAGCAGCAGTGGGGGCCATGGAGGACAAATCTGCTGAGCACAAAAGAACTCAATATTCCTGCTATTGCTGCAAACTGAGTATGAAAGAAGGTGACCCAGCCATCTATGCCGAAAGGGCTGGCTATGATAAACTGTGGCACCCAGCTTGTTTTGTCTGCAGCACCTGCCATGAACTCCTGGTTGACATGATTTATTTTTGGAAGAATGAGAAGCTATACTGTGGCAGACATTACTGTGACAGCGAGAAACCCCGATGTGCTGGCTGTGACGAGCTGATATTCAGCAATGAGTATACCCAGGCAGAAAACCAGAATTGGCACCTGAAACACTTCTGCTGCTTTGACTGTGATAGCATTCTAGCTGGGGAGATATACGTGATGGTCAATGACAAGCCCGTGTGCAAGCCCTGCTATGTGAAGAATCACGCTGTGGTGTGTCAAGGATGCCACAATGCCATCGACCCAGAAGTGCAGCGGGTGACCTATAACAATTTCAGCTGGCATGCATCCACAGAGTGCTTTCTGTGCTCTTGCTGCAGCAAATGCCTCATTGGGCAGAAGTTCATGCCAGTAGAAGGGATGGTTTTCTGTTCAGTGGAATGTAAGAAGAGGATGTCTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2352-Ab Anti-TES/ TESSS-2 monoclonal antibody
    Target Antigen GM-Tg-g-MP2352-Ag TES VLP (virus-like particle)
    ORF Viral Vector pGMLV000115 Human TES Lentivirus plasmid
    ORF Viral Vector pGMLV001926 Human TES Lentivirus plasmid
    ORF Viral Vector pGMLP005111 Human TES Lentivirus plasmid
    ORF Viral Vector vGMLV000115 Human TES Lentivirus particle
    ORF Viral Vector vGMLV001926 Human TES Lentivirus particle
    ORF Viral Vector vGMLP005111 Human TES Lentivirus particle


    Target information

    Target ID GM-MP2352
    Target Name TES
    Gene ID 26136, 21753, 706879, 500040, 100137197, 475293, 534965, 100071093
    Gene Symbol and Synonyms D6Ertd352e,TES,Tes1,Tes2,TESS,TESS-2,Testin,testin2
    Uniprot Accession Q9UGI8
    Uniprot Entry Name TES_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000135269
    Target Classification Tumor-associated antigen (TAA)

    Cancer-associated chromosomal changes often involve regions containing fragile sites. This gene maps to a commom fragile site on chromosome 7q31.2 designated FRA7G. This gene is similar to mouse Testin, a testosterone-responsive gene encoding a Sertoli cell secretory protein containing three LIM domains. LIM domains are double zinc-finger motifs that mediate protein-protein interactions between transcription factors, cytoskeletal proteins and signaling proteins. This protein is a negative regulator of cell growth and may act as a tumor suppressor. This scaffold protein may also play a role in cell adhesion, cell spreading and in the reorganization of the actin cytoskeleton. Multiple protein isoforms are encoded by transcript variants of this gene.[provided by RefSeq, Mar 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.