Human TES/TESS/ TESS-2 ORF/cDNA clone-Lentivirus particle (NM_015641.4)
Pre-made Human TES/TESS/ TESS-2 Lentiviral expression plasmid for TES lentivirus packaging, TES lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TES/TESS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001926 | Human TES Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001926 |
Gene Name | TES |
Accession Number | NM_015641.4 |
Gene ID | 26136 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1266 bp |
Gene Alias | TESS, TESS-2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCTGGAAAACAAAGTGAAGAAGATGGGCTTAGGTCACGAGCAAGGATTTGGAGCCCCTTGTTTAAAATGCAAAGAAAAATGTGAAGGATTCGAACTGCACTTCTGGAGAAAAATATGTCGTAACTGCAAGTGTGGCCAAGAAGAGCATGATGTCCTCTTGAGCAATGAAGAGGATCGAAAAGTGGGAAAACTTTTTGAAGACACCAAGTATACCACTCTGATTGCAAAACTAAAGTCAGATGGAATTCCCATGTATAAACGCAATGTTATGATATTGACGAATCCAGTTGCTGCCAAGAAGAATGTCTCCATCAATACAGTTACCTATGAGTGGGCTCCTCCTGTCCAGAATCAAGCATTGGCCAGGCAGTACATGCAGATGCTACCCAAGGAAAAGCAGCCAGTAGCAGGCTCAGAGGGGGCACAGTACCGGAAGAAGCAGCTGGCAAAGCAGCTCCCTGCACATGACCAGGACCCTTCAAAGTGCCATGAGTTGTCTCCCAGAGAGGTGAAGGAGATGGAGCAGTTTGTGAAGAAATATAAGAGCGAAGCTCTGGGAGTAGGAGATGTCAAACTTCCCTGTGAGATGGATGCCCAAGGCCCCAAACAAATGAACATTCCTGGAGGGGATAGAAGCACCCCAGCAGCAGTGGGGGCCATGGAGGACAAATCTGCTGAGCACAAAAGAACTCAATATTCCTGCTATTGCTGCAAACTGAGTATGAAAGAAGGTGACCCAGCCATCTATGCCGAAAGGGCTGGCTATGATAAACTGTGGCACCCAGCTTGTTTTGTCTGCAGCACCTGCCATGAACTCCTGGTTGACATGATTTATTTTTGGAAGAATGAGAAGCTATACTGTGGCAGACATTACTGTGACAGCGAGAAACCCCGATGTGCTGGCTGTGACGAGCTGATATTCAGCAATGAGTATACCCAGGCAGAAAACCAGAATTGGCACCTGAAACACTTCTGCTGCTTTGACTGTGATAGCATTCTAGCTGGGGAGATATACGTGATGGTCAATGACAAGCCCGTGTGCAAGCCCTGCTATGTGAAGAATCACGCTGTGGTGTGTCAAGGATGCCACAATGCCATCGACCCAGAAGTGCAGCGGGTGACCTATAACAATTTCAGCTGGCATGCATCCACAGAGTGCTTTCTGTGCTCTTGCTGCAGCAAATGCCTCATTGGGCAGAAGTTCATGCCAGTAGAAGGGATGGTTTTCTGTTCAGTGGAATGTAAGAAGAGGATGTCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2352-Ab | Anti-TES/ TESSS-2 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2352-Ag | TES VLP (virus-like particle) |
ORF Viral Vector | pGMLV000115 | Human TES Lentivirus plasmid |
ORF Viral Vector | pGMLV001926 | Human TES Lentivirus plasmid |
ORF Viral Vector | pGMLP005111 | Human TES Lentivirus plasmid |
ORF Viral Vector | vGMLV000115 | Human TES Lentivirus particle |
ORF Viral Vector | vGMLV001926 | Human TES Lentivirus particle |
ORF Viral Vector | vGMLP005111 | Human TES Lentivirus particle |
Target information
Target ID | GM-MP2352 |
Target Name | TES |
Gene ID | 26136, 21753, 706879, 500040, 100137197, 475293, 534965, 100071093 |
Gene Symbol and Synonyms | D6Ertd352e,TES,Tes1,Tes2,TESS,TESS-2,Testin,testin2 |
Uniprot Accession | Q9UGI8 |
Uniprot Entry Name | TES_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000135269 |
Target Classification | Tumor-associated antigen (TAA) |
Cancer-associated chromosomal changes often involve regions containing fragile sites. This gene maps to a commom fragile site on chromosome 7q31.2 designated FRA7G. This gene is similar to mouse Testin, a testosterone-responsive gene encoding a Sertoli cell secretory protein containing three LIM domains. LIM domains are double zinc-finger motifs that mediate protein-protein interactions between transcription factors, cytoskeletal proteins and signaling proteins. This protein is a negative regulator of cell growth and may act as a tumor suppressor. This scaffold protein may also play a role in cell adhesion, cell spreading and in the reorganization of the actin cytoskeleton. Multiple protein isoforms are encoded by transcript variants of this gene.[provided by RefSeq, Mar 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.