Human SCN3B/ATFB16/BRGDA7 ORF/cDNA clone-Lentivirus plasmid (NM_018400)

Cat. No.: pGMLP005128
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SCN3B/ATFB16/BRGDA7 Lentiviral expression plasmid for SCN3B lentivirus packaging, SCN3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SCN3B/ATFB16 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $462
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005128
Gene Name SCN3B
Accession Number NM_018400
Gene ID 55800
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 648 bp
Gene Alias ATFB16,BRGDA7,HSA243396,SCNB3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTGCCTTCAATAGATTGTTTCCCCTGGCTTCTCTCGTGCTTATCTACTGGGTCAGTGTCTGCTTCCCTGTGTGTGTGGAAGTGCCCTCGGAGACGGAGGCCGTGCAGGGCAACCCCATGAAGCTGCGCTGCATCTCCTGCATGAAGAGAGAGGAGGTGGAGGCCACCACGGTGGTGGAATGGTTCTACAGGCCCGAGGGCGGTAAAGATTTCCTTATTTACGAGTATCGGAATGGCCACCAGGAGGTGGAGAGCCCCTTTCAGGGGCGCCTGCAGTGGAATGGCAGCAAGGACCTGCAGGACGTGTCCATCACTGTGCTCAACGTCACTCTGAACGACTCTGGCCTCTACACCTGCAATGTGTCCCGGGAGTTTGAGTTTGAGGCGCATCGGCCCTTTGTGAAGACGACGCGGCTGATCCCCCTAAGAGTCACCGAGGAGGCTGGAGAGGACTTCACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG
ORF Protein Sequence MPAFNRLFPLASLVLIYWVSVCFPVCVEVPSETEAVQGNPMKLRCISCMKREEVEATTVVEWFYRPEGGKDFLIYEYRNGHQEVESPFQGRLQWNGSKDLQDVSITVLNVTLNDSGLYTCNVSREFEFEAHRPFVKTTRLIPLRVTEEAGEDFTSVVSEIMMYILLVFLTLWLLIEMIYCYRKVSKAEEAAQENASDYLAIPSENKENSAVPVEE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1489-Ab Anti-SCN3B/ ATFB16/ BRGDA7 monoclonal antibody
    Target Antigen GM-Tg-g-MP1489-Ag SCN3B VLP (virus-like particle)
    ORF Viral Vector pGMLP005128 Human SCN3B Lentivirus plasmid
    ORF Viral Vector vGMLP005128 Human SCN3B Lentivirus particle


    Target information

    Target ID GM-MP1489
    Target Name SCN3B
    Gene ID 55800, 235281, 714673, 245956, 101088103, 610239, 540925, 100071718
    Gene Symbol and Synonyms 1110001K16Rik,4833414B02Rik,ATFB16,BRGDA7,HSA243396,SCN3B,SCNB3
    Uniprot Accession Q9NY72
    Uniprot Entry Name SCN3B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166257
    Target Classification Not Available

    Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.