Human SCN3B/ATFB16/BRGDA7 ORF/cDNA clone-Lentivirus particle (NM_018400)
Cat. No.: vGMLP005128
Pre-made Human SCN3B/ATFB16/BRGDA7 Lentiviral expression plasmid for SCN3B lentivirus packaging, SCN3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
SCN3B/ATFB16 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP005128 | Human SCN3B Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP005128 |
| Gene Name | SCN3B |
| Accession Number | NM_018400 |
| Gene ID | 55800 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 648 bp |
| Gene Alias | ATFB16,BRGDA7,HSA243396,SCNB3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCTGCCTTCAATAGATTGTTTCCCCTGGCTTCTCTCGTGCTTATCTACTGGGTCAGTGTCTGCTTCCCTGTGTGTGTGGAAGTGCCCTCGGAGACGGAGGCCGTGCAGGGCAACCCCATGAAGCTGCGCTGCATCTCCTGCATGAAGAGAGAGGAGGTGGAGGCCACCACGGTGGTGGAATGGTTCTACAGGCCCGAGGGCGGTAAAGATTTCCTTATTTACGAGTATCGGAATGGCCACCAGGAGGTGGAGAGCCCCTTTCAGGGGCGCCTGCAGTGGAATGGCAGCAAGGACCTGCAGGACGTGTCCATCACTGTGCTCAACGTCACTCTGAACGACTCTGGCCTCTACACCTGCAATGTGTCCCGGGAGTTTGAGTTTGAGGCGCATCGGCCCTTTGTGAAGACGACGCGGCTGATCCCCCTAAGAGTCACCGAGGAGGCTGGAGAGGACTTCACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG |
| ORF Protein Sequence | MPAFNRLFPLASLVLIYWVSVCFPVCVEVPSETEAVQGNPMKLRCISCMKREEVEATTVVEWFYRPEGGKDFLIYEYRNGHQEVESPFQGRLQWNGSKDLQDVSITVLNVTLNDSGLYTCNVSREFEFEAHRPFVKTTRLIPLRVTEEAGEDFTSVVSEIMMYILLVFLTLWLLIEMIYCYRKVSKAEEAAQENASDYLAIPSENKENSAVPVEE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP1489-Ab | Anti-SCN3B/ ATFB16/ BRGDA7 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP1489-Ag | SCN3B VLP (virus-like particle) |
| ORF Viral Vector | pGMLP005128 | Human SCN3B Lentivirus plasmid |
| ORF Viral Vector | vGMLP005128 | Human SCN3B Lentivirus particle |
Target information
| Target ID | GM-MP1489 |
| Target Name | SCN3B |
| Gene ID | 55800, 235281, 714673, 245956, 101088103, 610239, 540925, 100071718 |
| Gene Symbol and Synonyms | 1110001K16Rik,4833414B02Rik,ATFB16,BRGDA7,HSA243396,SCN3B,SCNB3 |
| Uniprot Accession | Q9NY72 |
| Uniprot Entry Name | SCN3B_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000166257 |
| Target Classification | Not Available |
Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


