Human CBS/CBSL/ HIP4 ORF/cDNA clone-Lentivirus plasmid (NM_000071.2)

Pre-made Human CBS/CBSL/ HIP4 Lentiviral expression plasmid for CBS lentivirus packaging, CBS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CBS/CBSL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000979 Human CBS Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000979
Gene Name CBS
Accession Number NM_000071.2
Gene ID 875
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1656 bp
Gene Alias CBSL, HIP4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85309-Ab Anti-CBS monoclonal antibody
    Target Antigen GM-Tg-g-T85309-Ag CBS protein
    ORF Viral Vector pGMLV000979 Human CBS Lentivirus plasmid
    ORF Viral Vector pGMLV001337 Human CBS Lentivirus plasmid
    ORF Viral Vector pGMAAV000608 Rat Cbs Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000707 Rat Cbs Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003973 Human CBS Lentivirus plasmid
    ORF Viral Vector pGMAP000190 Human CBS Adenovirus plasmid
    ORF Viral Vector pGMAP000387 Human CBS Adenovirus plasmid
    ORF Viral Vector pGMAP000526 Human CBS Adenovirus plasmid
    ORF Viral Vector vGMLV000979 Human CBS Lentivirus particle
    ORF Viral Vector vGMLV001337 Human CBS Lentivirus particle
    ORF Viral Vector vGMAAV000608 Rat Cbs Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000707 Rat Cbs Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003973 Human CBS Lentivirus particle
    ORF Viral Vector vGMAP000190 Human CBS Adenovirus particle
    ORF Viral Vector vGMAP000387 Human CBS Adenovirus particle
    ORF Viral Vector vGMAP000526 Human CBS Adenovirus particle


    Target information

    Target ID GM-T85309
    Target Name CBS
    Gene ID 875, 12411, 100423684, 24250, 101093038, 611071, 514525
    Gene Symbol and Synonyms CBS,CBSL,HIP4
    Uniprot Accession P35520
    Uniprot Entry Name CBS_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000160200
    Target Classification Not Available

    The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.