- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CBS/CBSL/ HIP4 ORF/cDNA clone-Lentivirus particle (NM_000071)
Pre-made Human CBS/CBSL/ HIP4 Lentiviral expression plasmid for CBS lentivirus packaging, CBS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CBS/CBSL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001337 | Human CBS Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001337 |
| Gene Name | CBS |
| Accession Number | NM_000071 |
| Gene ID | 875 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1656 bp |
| Gene Alias | CBSL, HIP4 |
| Fluorescent Reporter | Luciferase |
| Mammalian Cell Selection | Puromyocinmyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T85309-Ab | Anti-CBS monoclonal antibody |
| Target Antigen | GM-Tg-g-T85309-Ag | CBS protein |
| ORF Viral Vector | pGMLV000979 | Human CBS Lentivirus plasmid |
| ORF Viral Vector | pGMLV001337 | Human CBS Lentivirus plasmid |
| ORF Viral Vector | pGMAAV000608 | Rat Cbs Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAAV000707 | Rat Cbs Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP003973 | Human CBS Lentivirus plasmid |
| ORF Viral Vector | pGMAP000190 | Human CBS Adenovirus plasmid |
| ORF Viral Vector | pGMAP000387 | Human CBS Adenovirus plasmid |
| ORF Viral Vector | pGMAP000526 | Human CBS Adenovirus plasmid |
| ORF Viral Vector | vGMLV000979 | Human CBS Lentivirus particle |
| ORF Viral Vector | vGMLV001337 | Human CBS Lentivirus particle |
| ORF Viral Vector | vGMAAV000608 | Rat Cbs Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAAV000707 | Rat Cbs Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP003973 | Human CBS Lentivirus particle |
| ORF Viral Vector | vGMAP000190 | Human CBS Adenovirus particle |
| ORF Viral Vector | vGMAP000387 | Human CBS Adenovirus particle |
| ORF Viral Vector | vGMAP000526 | Human CBS Adenovirus particle |
Target information
| Target ID | GM-T85309 |
| Target Name | CBS |
| Gene ID | 875, 12411, 100423684, 24250, 101093038, 611071, 514525 |
| Gene Symbol and Synonyms | CBS,CBSL,HIP4 |
| Uniprot Accession | P35520 |
| Uniprot Entry Name | CBS_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | Not Available |
| Gene Ensembl | ENSG00000160200 |
| Target Classification | Not Available |
The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
