Human HTRA1/ARMD7/ CADASIL2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002775.5)
Pre-made Human HTRA1/ARMD7/ CADASIL2 Non-Viral expression plasmid (overexpression vector) for mouse HTRA1 overexpression in unique cell transient transfection and stable cell line development.
Go
to HTRA1/ARMD7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000585 | Human HTRA1 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000585 |
Gene Name | HTRA1 |
Accession Number | NM_002775.5 |
Gene ID | 5654 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1443 bp |
Gene Alias | ARMD7, CADASIL2, CARASIL, HtrA, L56, ORF480, PRSS11 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGATCCCGCGCGCCGCTCTTCTCCCGCTGCTGCTGCTGCTGCTGGCGGCGCCCGCCTCGGCGCAGCTGTCCCGGGCCGGCCGCTCGGCGCCTTTGGCCGCCGGGTGCCCAGACCGCTGCGAGCCGGCGCGCTGCCCGCCGCAGCCGGAGCACTGCGAGGGCGGCCGGGCCCGGGACGCGTGCGGCTGCTGCGAGGTGTGCGGCGCGCCCGAGGGCGCCGCGTGCGGCCTGCAGGAGGGCCCGTGCGGCGAGGGGCTGCAGTGCGTGGTGCCCTTCGGGGTGCCAGCCTCGGCCACGGTGCGGCGGCGCGCGCAGGCCGGCCTCTGTGTGTGCGCCAGCAGCGAGCCGGTGTGCGGCAGCGACGCCAACACCTACGCCAACCTGTGCCAGCTGCGCGCCGCCAGCCGCCGCTCCGAGAGGCTGCACCGGCCGCCGGTCATCGTCCTGCAGCGCGGAGCCTGCGGCCAAGGGCAGGAAGATCCCAACAGTTTGCGCCATAAATATAACTTTATCGCGGACGTGGTGGAGAAGATCGCCCCTGCCGTGGTTCATATCGAATTGTTTCGCAAGCTTCCGTTTTCTAAACGAGAGGTGCCGGTGGCTAGTGGGTCTGGGTTTATTGTGTCGGAAGATGGACTGATCGTGACAAATGCCCACGTGGTGACCAACAAGCACCGGGTCAAAGTTGAGCTGAAGAACGGTGCCACTTACGAAGCCAAAATCAAGGATGTGGATGAGAAAGCAGACATCGCACTCATCAAAATTGACCACCAGGGCAAGCTGCCTGTCCTGCTGCTTGGCCGCTCCTCAGAGCTGCGGCCGGGAGAGTTCGTGGTCGCCATCGGAAGCCCGTTTTCCCTTCAAAACACAGTCACCACCGGGATCGTGAGCACCACCCAGCGAGGCGGCAAAGAGCTGGGGCTCCGCAACTCAGACATGGACTACATCCAGACCGACGCCATCATCAACTATGGAAACTCGGGAGGCCCGTTAGTAAACCTGGACGGTGAAGTGATTGGAATTAACACTTTGAAAGTGACAGCTGGAATCTCCTTTGCAATCCCATCTGATAAGATTAAAAAGTTCCTCACGGAGTCCCATGACCGACAGGCCAAAGGAAAAGCCATCACCAAGAAGAAGTATATTGGTATCCGAATGATGTCACTCACGTCCAGCAAAGCCAAAGAGCTGAAGGACCGGCACCGGGACTTCCCAGACGTGATCTCAGGAGCGTATATAATTGAAGTAATTCCTGATACCCCAGCAGAAGCTGGTGGTCTCAAGGAAAACGACGTCATAATCAGCATCAATGGACAGTCCGTGGTCTCCGCCAATGATGTCAGCGACGTCATTAAAAGGGAAAGCACCCTGAACATGGTGGTCCGCAGGGGTAATGAAGATATCATGATCACAGTGATTCCCGAAGAAATTGACCCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-668 | Pre-Made Galegenimab biosimilar, Whole mAb, Anti-HTRA1 Antibody: Anti-ARMD7/CADASIL2/CARASIL/HtrA/L56/ORF480/PRSS11 therapeutic antibody |
Target Antibody | GM-Tg-g-T17642-Ab | Anti-HTRA1/ ARMD7/ CADASIL2 monoclonal antibody |
Target Antigen | GM-Tg-g-T17642-Ag | HTRA1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV001033 | Human HTRA1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000147 | Human HTRA1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000585 | Human HTRA1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV001033 | Human HTRA1 Lentivirus particle |
ORF Viral Vector | vGMAD000147 | Human HTRA1 Adenovirus particle |
Target information
Target ID | GM-T17642 |
Target Name | HTRA1 |
Gene ID | 5654, 56213, 705855, 65164, 101095920, 477852, 282326, 100064570 |
Gene Symbol and Synonyms | ARMD7,CADASIL2,CARASIL,HtrA,HTRA1,L56,ORF480,PRSS11,RSPP11 |
Uniprot Accession | Q92743 |
Uniprot Entry Name | HTRA1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Ovary Cancer, small vessel disease (SVD) |
Gene Ensembl | ENSG00000166033 |
Target Classification | Not Available |
This gene encodes a member of the trypsin family of serine proteases. This protein is a secreted enzyme that is proposed to regulate the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins. It has also been suggested to be a regulator of cell growth. Variations in the promoter region of this gene are the cause of susceptibility to age-related macular degeneration type 7. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.