Human HTRA1/ARMD7/ CADASIL2 ORF/cDNA clone-Lentivirus plasmid (NM_002775.5)

Pre-made Human HTRA1/ARMD7/ CADASIL2 Lentiviral expression plasmid for HTRA1 lentivirus packaging, HTRA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HTRA1/ARMD7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001033 Human HTRA1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001033
Gene Name HTRA1
Accession Number NM_002775.5
Gene ID 5654
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1443 bp
Gene Alias ARMD7, CADASIL2, CARASIL, HtrA, L56, ORF480, PRSS11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGATCCCGCGCGCCGCTCTTCTCCCGCTGCTGCTGCTGCTGCTGGCGGCGCCCGCCTCGGCGCAGCTGTCCCGGGCCGGCCGCTCGGCGCCTTTGGCCGCCGGGTGCCCAGACCGCTGCGAGCCGGCGCGCTGCCCGCCGCAGCCGGAGCACTGCGAGGGCGGCCGGGCCCGGGACGCGTGCGGCTGCTGCGAGGTGTGCGGCGCGCCCGAGGGCGCCGCGTGCGGCCTGCAGGAGGGCCCGTGCGGCGAGGGGCTGCAGTGCGTGGTGCCCTTCGGGGTGCCAGCCTCGGCCACGGTGCGGCGGCGCGCGCAGGCCGGCCTCTGTGTGTGCGCCAGCAGCGAGCCGGTGTGCGGCAGCGACGCCAACACCTACGCCAACCTGTGCCAGCTGCGCGCCGCCAGCCGCCGCTCCGAGAGGCTGCACCGGCCGCCGGTCATCGTCCTGCAGCGCGGAGCCTGCGGCCAAGGGCAGGAAGATCCCAACAGTTTGCGCCATAAATATAACTTTATCGCGGACGTGGTGGAGAAGATCGCCCCTGCCGTGGTTCATATCGAATTGTTTCGCAAGCTTCCGTTTTCTAAACGAGAGGTGCCGGTGGCTAGTGGGTCTGGGTTTATTGTGTCGGAAGATGGACTGATCGTGACAAATGCCCACGTGGTGACCAACAAGCACCGGGTCAAAGTTGAGCTGAAGAACGGTGCCACTTACGAAGCCAAAATCAAGGATGTGGATGAGAAAGCAGACATCGCACTCATCAAAATTGACCACCAGGGCAAGCTGCCTGTCCTGCTGCTTGGCCGCTCCTCAGAGCTGCGGCCGGGAGAGTTCGTGGTCGCCATCGGAAGCCCGTTTTCCCTTCAAAACACAGTCACCACCGGGATCGTGAGCACCACCCAGCGAGGCGGCAAAGAGCTGGGGCTCCGCAACTCAGACATGGACTACATCCAGACCGACGCCATCATCAACTATGGAAACTCGGGAGGCCCGTTAGTAAACCTGGACGGTGAAGTGATTGGAATTAACACTTTGAAAGTGACAGCTGGAATCTCCTTTGCAATCCCATCTGATAAGATTAAAAAGTTCCTCACGGAGTCCCATGACCGACAGGCCAAAGGAAAAGCCATCACCAAGAAGAAGTATATTGGTATCCGAATGATGTCACTCACGTCCAGCAAAGCCAAAGAGCTGAAGGACCGGCACCGGGACTTCCCAGACGTGATCTCAGGAGCGTATATAATTGAAGTAATTCCTGATACCCCAGCAGAAGCTGGTGGTCTCAAGGAAAACGACGTCATAATCAGCATCAATGGACAGTCCGTGGTCTCCGCCAATGATGTCAGCGACGTCATTAAAAGGGAAAGCACCCTGAACATGGTGGTCCGCAGGGGTAATGAAGATATCATGATCACAGTGATTCCCGAAGAAATTGACCCATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-668 Pre-Made Galegenimab biosimilar, Whole mAb, Anti-HTRA1 Antibody: Anti-ARMD7/CADASIL2/CARASIL/HtrA/L56/ORF480/PRSS11 therapeutic antibody
    Target Antibody GM-Tg-g-T17642-Ab Anti-HTRA1/ ARMD7/ CADASIL2 monoclonal antibody
    Target Antigen GM-Tg-g-T17642-Ag HTRA1 VLP (virus-like particle)
    ORF Viral Vector pGMLV001033 Human HTRA1 Lentivirus plasmid
    ORF Viral Vector pGMAD000147 Human HTRA1 Adenovirus plasmid
    ORF Viral Vector pGMPC000585 Human HTRA1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001033 Human HTRA1 Lentivirus particle
    ORF Viral Vector vGMAD000147 Human HTRA1 Adenovirus particle


    Target information

    Target ID GM-T17642
    Target Name HTRA1
    Gene ID 5654, 56213, 705855, 65164, 101095920, 477852, 282326, 100064570
    Gene Symbol and Synonyms ARMD7,CADASIL2,CARASIL,HtrA,HTRA1,L56,ORF480,PRSS11,RSPP11
    Uniprot Accession Q92743
    Uniprot Entry Name HTRA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Ovary Cancer, small vessel disease (SVD)
    Gene Ensembl ENSG00000166033
    Target Classification Not Available

    This gene encodes a member of the trypsin family of serine proteases. This protein is a secreted enzyme that is proposed to regulate the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins. It has also been suggested to be a regulator of cell growth. Variations in the promoter region of this gene are the cause of susceptibility to age-related macular degeneration type 7. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.