Human EVA1A/FAM176A/TMEM166 ORF/cDNA clone-Adenovirus particle (NM_001135032.1)
Cat. No.: vGMAD000066
Pre-made Human EVA1A/FAM176A/TMEM166 Adenovirus for EVA1A overexpression in-vitro and in-vivo. The EVA1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified EVA1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
EVA1A/FAM176A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000066 | Human EVA1A Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000066 |
Gene Name | EVA1A |
Accession Number | NM_001135032.1 |
Gene ID | 84141 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 459 bp |
Gene Alias | FAM176A,TMEM166 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGGCTGCCCCTCAGCCACAGCCCAGAGCACGTGGAGATGGCTTTGCTCAGCAACATCCTAGCGGCCTATTCCTTTGTCTCAGAAAATCCTGAGCGAGCAGCTCTGTACTTTGTTTCTGGCGTGTGCATCGGGCTGGTGCTGACCCTGGCTGCTCTGGTGATAAGGATCTCTTGCCACACAGACTGCAGGCGGCGTCCCGGGAAGAAGTTCCTGCAGGACAGAGAGAGCAGCAGCGACAGCAGCGACAGCGAGGATGGCAGTGAGGACACCGTGTCCGATCTCTCCGTGCGGAGACACCGCCGCTTCGAGAGGACTTTGAACAAGAATGTGTTCACCTCTGCGGAGGAGCTGGAGCGCGCCCAGCGGCTGGAGGAGCGCGAGCGCATCATCAGGGAGATCTGGATGAATGGCCAGCCTGAGGTGCCCGGGACCAGGAGCCTGAATCGCTACTATTAG |
ORF Protein Sequence | MRLPLSHSPEHVEMALLSNILAAYSFVSENPERAALYFVSGVCIGLVLTLAALVIRISCHTDCRRRPGKKFLQDRESSSDSSDSEDGSEDTVSDLSVRRHRRFERTLNKNVFTSAEELERAQRLEERERIIREIWMNGQPEVPGTRSLNRYY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0428-Ab | Anti-EVA1A/ FAM176A/ TMEM166 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0428-Ag | EVA1A VLP (virus-like particle) |
ORF Viral Vector | pGMLV000817 | Human EVA1A Lentivirus plasmid |
ORF Viral Vector | pGMAD000066 | Human EVA1A Adenovirus plasmid |
ORF Viral Vector | vGMLV000817 | Human EVA1A Lentivirus particle |
ORF Viral Vector | vGMAD000066 | Human EVA1A Adenovirus particle |
Target information
Target ID | GM-MP0428 |
Target Name | EVA1A |
Gene ID | 84141, 232146, 710843, 500221, 101080449, 483095, 528994, 100068811 |
Gene Symbol and Synonyms | EVA1A,FAM176A,RGD1559797,TMEM166 |
Uniprot Accession | Q9H8M9 |
Uniprot Entry Name | EVA1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000115363 |
Target Classification | Not Available |
Predicted to be involved in apoptotic process and autophagy. Located in intracellular membrane-bounded organelle and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.