Human EVA1A/FAM176A/TMEM166 ORF/cDNA clone-Lentivirus plasmid (NM_001135032.1)

Cat. No.: pGMLV000817
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EVA1A/FAM176A/TMEM166 Lentiviral expression plasmid for EVA1A lentivirus packaging, EVA1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to EVA1A/FAM176A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000817
Gene Name EVA1A
Accession Number NM_001135032.1
Gene ID 84141
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 459 bp
Gene Alias FAM176A,TMEM166
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCTGCCCCTCAGCCACAGCCCAGAGCACGTGGAGATGGCTTTGCTCAGCAACATCCTAGCGGCCTATTCCTTTGTCTCAGAAAATCCTGAGCGAGCAGCTCTGTACTTTGTTTCTGGCGTGTGCATCGGGCTGGTGCTGACCCTGGCTGCTCTGGTGATAAGGATCTCTTGCCACACAGACTGCAGGCGGCGTCCCGGGAAGAAGTTCCTGCAGGACAGAGAGAGCAGCAGCGACAGCAGCGACAGCGAGGATGGCAGTGAGGACACCGTGTCCGATCTCTCCGTGCGGAGACACCGCCGCTTCGAGAGGACTTTGAACAAGAATGTGTTCACCTCTGCGGAGGAGCTGGAGCGCGCCCAGCGGCTGGAGGAGCGCGAGCGCATCATCAGGGAGATCTGGATGAATGGCCAGCCTGAGGTGCCCGGGACCAGGAGCCTGAATCGCTACTATTAG
ORF Protein Sequence MRLPLSHSPEHVEMALLSNILAAYSFVSENPERAALYFVSGVCIGLVLTLAALVIRISCHTDCRRRPGKKFLQDRESSSDSSDSEDGSEDTVSDLSVRRHRRFERTLNKNVFTSAEELERAQRLEERERIIREIWMNGQPEVPGTRSLNRYY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0428-Ab Anti-EVA1A/ FAM176A/ TMEM166 monoclonal antibody
    Target Antigen GM-Tg-g-MP0428-Ag EVA1A VLP (virus-like particle)
    ORF Viral Vector pGMLV000817 Human EVA1A Lentivirus plasmid
    ORF Viral Vector pGMAD000066 Human EVA1A Adenovirus plasmid
    ORF Viral Vector vGMLV000817 Human EVA1A Lentivirus particle
    ORF Viral Vector vGMAD000066 Human EVA1A Adenovirus particle


    Target information

    Target ID GM-MP0428
    Target Name EVA1A
    Gene ID 84141, 232146, 710843, 500221, 101080449, 483095, 528994, 100068811
    Gene Symbol and Synonyms EVA1A,FAM176A,RGD1559797,TMEM166
    Uniprot Accession Q9H8M9
    Uniprot Entry Name EVA1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000115363
    Target Classification Not Available

    Predicted to be involved in apoptotic process and autophagy. Located in intracellular membrane-bounded organelle and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.