Human SIRT3/SIR2L3 ORF/cDNA clone-Adenovirus particle (NM_012239.5)
Cat. No.: vGMAD000464
Pre-made Human SIRT3/SIR2L3 Adenovirus for SIRT3 overexpression in-vitro and in-vivo. The SIRT3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SIRT3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
SIRT3/SIR2L3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000464 | Human SIRT3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000464 |
Gene Name | SIRT3 |
Accession Number | NM_012239.5 |
Gene ID | 23410 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1200 bp |
Gene Alias | SIR2L3 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Null |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGGGGCCGGGTAGTTGAACGGGTCGAGGCCGGGGGAGGCGTGGGGCCGTTTCAGGCCTGCGGCTGTCGGCTGGTGCTTGGCGGCAGGGACGATGTGAGTGCGGGGCTGAGAGGCAGCCATGGGGCCCGCGGTGAGCCCTTGGACCCGGCGCGCCCCTTGCAGAGGCCTCCCAGACCCGAGGTGCCCAGGGCATTCCGGAGGCAGCCGAGGGCAGCAGCTCCCAGTTTCTTCTTTTCGAGTATTAAAGGTGGAAGAAGGTCCATATCTTTTTCTGTGGGTGCTTCAAGTGTTGTTGGAAGTGGAGGCAGCAGTGACAAGGGGAAGCTTTCCCTGCAGGATGTAGCTGAGCTGATTCGGGCCAGAGCCTGCCAGAGGGTGGTGGTCATGGTGGGGGCCGGCATCAGCACACCCAGTGGCATTCCAGACTTCAGATCGCCGGGGAGTGGCCTGTACAGCAACCTCCAGCAGTACGATCTCCCGTACCCCGAGGCCATTTTTGAACTCCCATTCTTCTTTCACAACCCCAAGCCCTTTTTCACTTTGGCCAAGGAGCTGTACCCTGGAAACTACAAGCCCAACGTCACTCACTACTTTCTCCGGCTGCTTCATGACAAGGGGCTGCTTCTGCGGCTCTACACGCAGAACATCGATGGGCTTGAGAGAGTGTCGGGCATCCCTGCCTCAAAGCTGGTTGAAGCTCATGGAACCTTTGCCTCTGCCACCTGCACAGTCTGCCAAAGACCCTTCCCAGGGGAGGACATTCGGGCTGACGTGATGGCAGACAGGGTTCCCCGCTGCCCGGTCTGCACCGGCGTTGTGAAGCCCGACATTGTGTTCTTTGGGGAGCCGCTGCCCCAGAGGTTCTTGCTGCATGTGGTTGATTTCCCCATGGCAGATCTGCTGCTCATCCTTGGGACCTCCCTGGAGGTGGAGCCTTTTGCCAGCTTGACCGAGGCCGTGCGGAGCTCAGTTCCCCGACTGCTCATCAACCGGGACTTGGTGGGGCCCTTGGCTTGGCATCCTCGCAGCAGGGACGTGGCCCAGCTGGGGGACGTGGTTCACGGCGTGGAAAGCCTAGTGGAGCTTCTGGGCTGGACAGAAGAGATGCGGGACCTTGTGCAGCGGGAAACTGGGAAGCTTGATGGACCAGACAAATAG |
ORF Protein Sequence | MAFWGWRAAAALRLWGRVVERVEAGGGVGPFQACGCRLVLGGRDDVSAGLRGSHGARGEPLDPARPLQRPPRPEVPRAFRRQPRAAAPSFFFSSIKGGRRSISFSVGASSVVGSGGSSDKGKLSLQDVAELIRARACQRVVVMVGAGISTPSGIPDFRSPGSGLYSNLQQYDLPYPEAIFELPFFFHNPKPFFTLAKELYPGNYKPNVTHYFLRLLHDKGLLLRLYTQNIDGLERVSGIPASKLVEAHGTFASATCTVCQRPFPGEDIRADVMADRVPRCPVCTGVVKPDIVFFGEPLPQRFLLHVVDFPMADLLLILGTSLEVEPFASLTEAVRSSVPRLLINRDLVGPLAWHPRSRDVAQLGDVVHGVESLVELLGWTEEMRDLVQRETGKLDGPDK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T91959-Ab | Anti-SIRT3 monoclonal antibody |
Target Antigen | GM-Tg-g-T91959-Ag | SIRT3 protein |
ORF Viral Vector | pGMLP002811 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMLV000991 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMLV001438 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMAD000249 | Human SIRT3 Adenovirus plasmid |
ORF Viral Vector | pGMAD000464 | Human SIRT3 Adenovirus plasmid |
ORF Viral Vector | pGMPC000237 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000393 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000866 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002811 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMLV000991 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMLV001438 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMAD000249 | Human SIRT3 Adenovirus particle |
ORF Viral Vector | vGMAD000464 | Human SIRT3 Adenovirus particle |
Target information
Target ID | GM-T91959 |
Target Name | SIRT3 |
Gene ID | 23410, 64384, 720737, 293615, 101087609, 475933, 614027, 100054908 |
Gene Symbol and Synonyms | 2310003L23Rik,SIR2L3,SIRT3 |
Uniprot Accession | Q9NTG7 |
Uniprot Entry Name | SIR3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000142082 |
Target Classification | Not Available |
SIRT3 encodes a member of the sirtuin family of class III histone deacetylases, homologs to the yeast Sir2 protein. The encoded protein is found exclusively in mitochondria, where it can eliminate reactive oxygen species, inhibit apoptosis, and prevent the formation of cancer cells. SIRT3 has far-reaching effects on nuclear gene expression, cancer, cardiovascular disease, neuroprotection, aging, and metabolic control. [provided by RefSeq, May 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.