Human SIRT3/SIR2L3 ORF/cDNA clone-Lentivirus plasmid (NM_001370310.1)

Pre-made Human SIRT3/SIR2L3 Lentiviral expression plasmid for SIRT3 lentivirus packaging, SIRT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SIRT3/SIR2L3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000991 Human SIRT3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000991
Gene Name SIRT3
Accession Number NM_001370310.1
Gene ID 23410
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1254 bp
Gene Alias SIR2L3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGGGGCCGGGTAGTTGAACGGGTCGAGGCCGGGGGAGGCGTGGGGCCGTTTCAGGCCTGCGGCTGTCGGCTGGTGCTTGGCGGCAGGGACGATGTGAGTGCGGGGCTGAGAGGCAGCCATGGGGCCCGCGGTGAGCCCTTGGACCCGGCGCGCCCCTTGCAGAGGCCTCCCAGACCCGAGGTGCCCAGGGCATTCCGGAGGCAGCCGAGGGCAGCAGCTCCCAGTTTCTTCTTTTCGAGTATTAAAGGTGGAAGAAGGTCCATATCTTTTTCTGTGGGTGCTTCAAGTGTTGTTGGAAGTGGAGGCAGCAGTGACAAGGGGAAGCTTTCCCTGCAGGATGTAGCTGAGCTGATTCGGGCCAGAGCCTGCCAGAGGGTGGTGGTCATGGTGGGGGCCGGCATCAGCACACCCAGTGGCATTCCAGACTTCAGATCGCCGGGGAGTGGCCTGTACAGCAACCTCCAGCAGTACGATCTCCCGTACCCCGAGGCCATTTTTGAACTCCCATTCTTCTTTCACAACCCCAAGCCCTTTTTCACTTTGGCCAAGGAGCTGTACCCTGGAAACTACAAGCCCAACGTCACTCACTACTTTCTCCGGCTGCTTCATGACAAGGGGCTGCTTCTGCGGCTCTACACGCAGAACATCGATGGGCTTGAGAGAGTGTCGGGCATCCCTGCCTCAAAGCTGGTTGAAGCTCATGGAACCTTTGCCTCTGCCACCTGCACAGTCTGCCAAAGACCCTTCCCAGGGGAGGACATTCGGGCTGACGTGATGGCAGACAGGGTTCCCCGCTGCCCGGTCTGCACCGGCGTTGTGAAGCCCGACATTGTGTTCTTTGGGGAGCCGCTGCCCCAGAGGTTCTTGCTGCATGTGGTTGATTTCCCCATGGCAGATCTGCTGCTCATCCTTGGGACCTCCCTGGAGGTGGAGCCTTTTGCCAGCTTGACCGAGGCCGTGCGGAGCTCAGTTCCCCGACTGCTCATCAACCGGGACTTGGTGGGGCCCTTGGCTTGGCATCCTCGCAGCAGGGACGTGGCCCAGCTGGGGGACGTGGTTCACGGCGTGGAAAGCCTAGTGGAGCTTCTGGGCTGGACAGAAGAGATGCGGGACCTTGTGCAGCGGGAAACTGGGAAGGTACAGACTGCTGAGGAGGACCATCCAAGGGGCTGCCCTTCTCACTGCTCTAGGCTTGATGGACCAGACAAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91959-Ab Anti-SIRT3 monoclonal antibody
    Target Antigen GM-Tg-g-T91959-Ag SIRT3 protein
    ORF Viral Vector pGMLV000991 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector pGMLV001438 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector pGMAD000084 Mouse Sirt3 Adenovirus plasmid
    ORF Viral Vector pGMAD000249 Human SIRT3 Adenovirus plasmid
    ORF Viral Vector pGMAD000464 Human SIRT3 Adenovirus plasmid
    ORF Viral Vector pGMPC000237 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000393 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000866 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002811 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector vGMLV000991 Human SIRT3 Lentivirus particle
    ORF Viral Vector vGMLV001438 Human SIRT3 Lentivirus particle
    ORF Viral Vector vGMAD000084 Mouse Sirt3 Adenovirus particle
    ORF Viral Vector vGMAD000249 Human SIRT3 Adenovirus particle
    ORF Viral Vector vGMAD000464 Human SIRT3 Adenovirus particle
    ORF Viral Vector vGMLP002811 Human SIRT3 Lentivirus particle


    Target information

    Target ID GM-T91959
    Target Name SIRT3
    Gene ID 23410, 64384, 720737, 293615, 101087609, 475933, 614027, 100054908
    Gene Symbol and Synonyms 2310003L23Rik,SIR2L3,SIRT3
    Uniprot Accession Q9NTG7
    Uniprot Entry Name SIR3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000142082
    Target Classification Not Available

    SIRT3 encodes a member of the sirtuin family of class III histone deacetylases, homologs to the yeast Sir2 protein. The encoded protein is found exclusively in mitochondria, where it can eliminate reactive oxygen species, inhibit apoptosis, and prevent the formation of cancer cells. SIRT3 has far-reaching effects on nuclear gene expression, cancer, cardiovascular disease, neuroprotection, aging, and metabolic control. [provided by RefSeq, May 2019]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.