Human SIRT3/SIR2L3 ORF/cDNA clone-Lentivirus plasmid (NM_001370310.1)
Cat. No.: pGMLV000991
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SIRT3/SIR2L3 Lentiviral expression plasmid for SIRT3 lentivirus packaging, SIRT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SIRT3/SIR2L3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000991 |
Gene Name | SIRT3 |
Accession Number | NM_001370310.1 |
Gene ID | 23410 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1254 bp |
Gene Alias | SIR2L3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGGGGCCGGGTAGTTGAACGGGTCGAGGCCGGGGGAGGCGTGGGGCCGTTTCAGGCCTGCGGCTGTCGGCTGGTGCTTGGCGGCAGGGACGATGTGAGTGCGGGGCTGAGAGGCAGCCATGGGGCCCGCGGTGAGCCCTTGGACCCGGCGCGCCCCTTGCAGAGGCCTCCCAGACCCGAGGTGCCCAGGGCATTCCGGAGGCAGCCGAGGGCAGCAGCTCCCAGTTTCTTCTTTTCGAGTATTAAAGGTGGAAGAAGGTCCATATCTTTTTCTGTGGGTGCTTCAAGTGTTGTTGGAAGTGGAGGCAGCAGTGACAAGGGGAAGCTTTCCCTGCAGGATGTAGCTGAGCTGATTCGGGCCAGAGCCTGCCAGAGGGTGGTGGTCATGGTGGGGGCCGGCATCAGCACACCCAGTGGCATTCCAGACTTCAGATCGCCGGGGAGTGGCCTGTACAGCAACCTCCAGCAGTACGATCTCCCGTACCCCGAGGCCATTTTTGAACTCCCATTCTTCTTTCACAACCCCAAGCCCTTTTTCACTTTGGCCAAGGAGCTGTACCCTGGAAACTACAAGCCCAACGTCACTCACTACTTTCTCCGGCTGCTTCATGACAAGGGGCTGCTTCTGCGGCTCTACACGCAGAACATCGATGGGCTTGAGAGAGTGTCGGGCATCCCTGCCTCAAAGCTGGTTGAAGCTCATGGAACCTTTGCCTCTGCCACCTGCACAGTCTGCCAAAGACCCTTCCCAGGGGAGGACATTCGGGCTGACGTGATGGCAGACAGGGTTCCCCGCTGCCCGGTCTGCACCGGCGTTGTGAAGCCCGACATTGTGTTCTTTGGGGAGCCGCTGCCCCAGAGGTTCTTGCTGCATGTGGTTGATTTCCCCATGGCAGATCTGCTGCTCATCCTTGGGACCTCCCTGGAGGTGGAGCCTTTTGCCAGCTTGACCGAGGCCGTGCGGAGCTCAGTTCCCCGACTGCTCATCAACCGGGACTTGGTGGGGCCCTTGGCTTGGCATCCTCGCAGCAGGGACGTGGCCCAGCTGGGGGACGTGGTTCACGGCGTGGAAAGCCTAGTGGAGCTTCTGGGCTGGACAGAAGAGATGCGGGACCTTGTGCAGCGGGAAACTGGGAAGGTACAGACTGCTGAGGAGGACCATCCAAGGGGCTGCCCTTCTCACTGCTCTAGGCTTGATGGACCAGACAAATAG |
ORF Protein Sequence | MAFWGWRAAAALRLWGRVVERVEAGGGVGPFQACGCRLVLGGRDDVSAGLRGSHGARGEPLDPARPLQRPPRPEVPRAFRRQPRAAAPSFFFSSIKGGRRSISFSVGASSVVGSGGSSDKGKLSLQDVAELIRARACQRVVVMVGAGISTPSGIPDFRSPGSGLYSNLQQYDLPYPEAIFELPFFFHNPKPFFTLAKELYPGNYKPNVTHYFLRLLHDKGLLLRLYTQNIDGLERVSGIPASKLVEAHGTFASATCTVCQRPFPGEDIRADVMADRVPRCPVCTGVVKPDIVFFGEPLPQRFLLHVVDFPMADLLLILGTSLEVEPFASLTEAVRSSVPRLLINRDLVGPLAWHPRSRDVAQLGDVVHGVESLVELLGWTEEMRDLVQRETGKVQTAEEDHPRGCPSHCSRLDGPDK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T91959-Ab | Anti-SIRT3 monoclonal antibody |
Target Antigen | GM-Tg-g-T91959-Ag | SIRT3 protein |
ORF Viral Vector | pGMLP002811 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMLV000991 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMLV001438 | Human SIRT3 Lentivirus plasmid |
ORF Viral Vector | pGMAD000249 | Human SIRT3 Adenovirus plasmid |
ORF Viral Vector | pGMAD000464 | Human SIRT3 Adenovirus plasmid |
ORF Viral Vector | pGMPC000237 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000393 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000866 | Human SIRT3 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002811 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMLV000991 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMLV001438 | Human SIRT3 Lentivirus particle |
ORF Viral Vector | vGMAD000249 | Human SIRT3 Adenovirus particle |
ORF Viral Vector | vGMAD000464 | Human SIRT3 Adenovirus particle |
Target information
Target ID | GM-T91959 |
Target Name | SIRT3 |
Gene ID | 23410, 64384, 720737, 293615, 101087609, 475933, 614027, 100054908 |
Gene Symbol and Synonyms | 2310003L23Rik,SIR2L3,SIRT3 |
Uniprot Accession | Q9NTG7 |
Uniprot Entry Name | SIR3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000142082 |
Target Classification | Not Available |
SIRT3 encodes a member of the sirtuin family of class III histone deacetylases, homologs to the yeast Sir2 protein. The encoded protein is found exclusively in mitochondria, where it can eliminate reactive oxygen species, inhibit apoptosis, and prevent the formation of cancer cells. SIRT3 has far-reaching effects on nuclear gene expression, cancer, cardiovascular disease, neuroprotection, aging, and metabolic control. [provided by RefSeq, May 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.