Human SIRT1/SIR2/ SIR2alpha ORF/cDNA clone-Adenovirus particle (NM_012238.4)
Pre-made Human SIRT1/SIR2/ SIR2alpha Adenovirus for SIRT1 overexpression in-vitro and in-vivo. The SIRT1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SIRT1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to SIRT1/SIR2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000579 | Human SIRT1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000579 |
Gene Name | SIRT1 |
Accession Number | NM_012238.4 |
Gene ID | 23411 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 2244 bp |
Gene Alias | SIR2, SIR2alpha, SIR2L1 |
Fluorescent Reporter | ERFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGACGAGGCGGCCCTCGCCCTTCAGCCCGGCGGCTCCCCCTCGGCGGCGGGGGCCGACAGGGAGGCCGCGTCGTCCCCCGCCGGGGAGCCGCTCCGCAAGAGGCCGCGGAGAGATGGTCCCGGCCTCGAGCGGAGCCCGGGCGAGCCCGGTGGGGCGGCCCCAGAGCGTGAGGTGCCGGCGGCGGCCAGGGGCTGCCCGGGTGCGGCGGCGGCGGCGCTGTGGCGGGAGGCGGAGGCAGAGGCGGCGGCGGCAGGCGGGGAGCAAGAGGCCCAGGCGACTGCGGCGGCTGGGGAAGGAGACAATGGGCCGGGCCTGCAGGGCCCATCTCGGGAGCCACCGCTGGCCGACAACTTGTACGACGAAGACGACGACGACGAGGGCGAGGAGGAGGAAGAGGCGGCGGCGGCGGCGATTGGGTACCGAGATAACCTTCTGTTCGGTGATGAAATTATCACTAATGGTTTTCATTCCTGTGAAAGTGATGAGGAGGATAGAGCCTCACATGCAAGCTCTAGTGACTGGACTCCAAGGCCACGGATAGGTCCATATACTTTTGTTCAGCAACATCTTATGATTGGCACAGATCCTCGAACAATTCTTAAAGATTTATTGCCGGAAACAATACCTCCACCTGAGTTGGATGATATGACACTGTGGCAGATTGTTATTAATATCCTTTCAGAACCACCAAAAAGGAAAAAAAGAAAAGATATTAATACAATTGAAGATGCTGTGAAATTACTGCAAGAGTGCAAAAAAATTATAGTTCTAACTGGAGCTGGGGTGTCTGTTTCATGTGGAATACCTGACTTCAGGTCAAGGGATGGTATTTATGCTCGCCTTGCTGTAGACTTCCCAGATCTTCCAGATCCTCAAGCGATGTTTGATATTGAATATTTCAGAAAAGATCCAAGACCATTCTTCAAGTTTGCAAAGGAAATATATCCTGGACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAGGAAGGAAAACTACTTCGCAACTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGAATCCAAAGGATAATTCAGTGTCATGGTTCCTTTGCAACAGCATCTTGCCTGATTTGTAAATACAAAGTTGACTGTGAAGCTGTACGAGGAGATATTTTTAATCAGGTAGTTCCTCGATGTCCTAGGTGCCCAGCTGATGAACCGCTTGCTATCATGAAACCAGAGATTGTGTTTTTTGGTGAAAATTTACCAGAACAGTTTCATAGAGCCATGAAGTATGACAAAGATGAAGTTGACCTCCTCATTGTTATTGGGTCTTCCCTCAAAGTAAGACCAGTAGCACTAATTCCAAGTTCCATACCCCATGAAGTGCCTCAGATATTAATTAATAGAGAACCTTTGCCTCATCTGCATTTTGATGTAGAGCTTCTTGGAGACTGTGATGTCATAATTAATGAATTGTGTCATAGGTTAGGTGGTGAATATGCCAAACTTTGCTGTAACCCTGTAAAGCTTTCAGAAATTACTGAAAAACCTCCACGAACACAAAAAGAATTGGCTTATTTGTCAGAGTTGCCACCCACACCTCTTCATGTTTCAGAAGACTCAAGTTCACCAGAAAGAACTTCACCACCAGATTCTTCAGTGATTGTCACACTTTTAGACCAAGCAGCTAAGAGTAATGATGATTTAGATGTGTCTGAATCAAAAGGTTGTATGGAAGAAAAACCACAGGAAGTACAAACTTCTAGGAATGTTGAAAGTATTGCTGAACAGATGGAAAATCCGGATTTGAAGAATGTTGGTTCTAGTACTGGGGAGAAAAATGAAAGAACTTCAGTGGCTGGAACAGTGAGAAAATGCTGGCCTAATAGAGTGGCAAAGGAGCAGATTAGTAGGCGGCTTGATGGTAATCAGTATCTGTTTTTGCCACCAAATCGTTACATTTTCCATGGCGCTGAGGTATATTCAGACTCTGAAGATGACGTCTTATCCTCTAGTTCTTGTGGCAGTAACAGTGATAGTGGGACATGCCAGAGTCCAAGTTTAGAAGAACCCATGGAGGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTAGAAGATGAGCCTGATGTTCCAGAGAGAGCTGGAGGAGCTGGATTTGGGACTGATGGAGATGATCAAGAGGCAATTAATGAAGCTATATCTGTGAAACAGGAAGTAACAGACATGAACTATCCATCAAACAAATCATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T14731-Ab | Anti-SIRT1 monoclonal antibody |
Target Antigen | GM-Tg-g-T14731-Ag | SIRT1 protein |
ORF Viral Vector | pGMLV000135 | Human SIRT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000525 | Human SIRT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000931 | Human SIRT1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000463 | Human SIRT1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000579 | Human SIRT1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000017 | Human SIRT1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000577 | Human SIRT1 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-135 | Human SIRT1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-275 | Human SIRT1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000135 | Human SIRT1 Lentivirus particle |
ORF Viral Vector | vGMLV000525 | Human SIRT1 Lentivirus particle |
ORF Viral Vector | vGMLV000931 | Human SIRT1 Lentivirus particle |
ORF Viral Vector | vGMAD000463 | Human SIRT1 Adenovirus particle |
ORF Viral Vector | vGMAD000579 | Human SIRT1 Adenovirus particle |
ORF Viral Vector | vGMAP000577 | Human SIRT1 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-135 | Human SIRT1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-275 | Human SIRT1 Adenovirus particle |
Target information
Target ID | GM-T14731 |
Target Name | SIRT1 |
Gene ID | 23411, 93759, 695682, 309757, 101087610, 489012, 613629, 100072571 |
Gene Symbol and Synonyms | SIR2,Sir2a,SIR2alpha,SIR2L1,SIRT1,sirtuin-1 |
Uniprot Accession | Q96EB6 |
Uniprot Entry Name | SIR1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000096717 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.