Human SIRT1/SIR2/ SIR2alpha ORF/cDNA clone-Lentivirus plasmid (NM_012238.5)

Pre-made Human SIRT1/SIR2/ SIR2alpha Lentiviral expression plasmid for SIRT1 lentivirus packaging, SIRT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SIRT1/SIR2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000931 Human SIRT1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000931
Gene Name SIRT1
Accession Number NM_012238.5
Gene ID 23411
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 2244 bp
Gene Alias SIR2, SIR2alpha, SIR2L1
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGACGAGGCGGCCCTCGCCCTTCAGCCCGGCGGCTCCCCCTCGGCGGCGGGGGCCGACAGGGAGGCCGCGTCGTCCCCCGCCGGGGAGCCGCTCCGCAAGAGGCCGCGGAGAGATGGTCCCGGCCTCGAGCGGAGCCCGGGCGAGCCCGGTGGGGCGGCCCCAGAGCGTGAGGTGCCGGCGGCGGCCAGGGGCTGCCCGGGTGCGGCGGCGGCGGCGCTGTGGCGGGAGGCGGAGGCAGAGGCGGCGGCGGCAGGCGGGGAGCAAGAGGCCCAGGCGACTGCGGCGGCTGGGGAAGGAGACAATGGGCCGGGCCTGCAGGGCCCATCTCGGGAGCCACCGCTGGCCGACAACTTGTACGACGAAGACGACGACGACGAGGGCGAGGAGGAGGAAGAGGCGGCGGCGGCGGCGATTGGGTACCGAGATAACCTTCTGTTCGGTGATGAAATTATCACTAATGGTTTTCATTCCTGTGAAAGTGATGAGGAGGATAGAGCCTCACATGCAAGCTCTAGTGACTGGACTCCAAGGCCACGGATAGGTCCATATACTTTTGTTCAGCAACATCTTATGATTGGCACAGATCCTCGAACAATTCTTAAAGATTTATTGCCGGAAACAATACCTCCACCTGAGTTGGATGATATGACACTGTGGCAGATTGTTATTAATATCCTTTCAGAACCACCAAAAAGGAAAAAAAGAAAAGATATTAATACAATTGAAGATGCTGTGAAATTACTGCAAGAGTGCAAAAAAATTATAGTTCTAACTGGAGCTGGGGTGTCTGTTTCATGTGGAATACCTGACTTCAGGTCAAGGGATGGTATTTATGCTCGCCTTGCTGTAGACTTCCCAGATCTTCCAGATCCTCAAGCGATGTTTGATATTGAATATTTCAGAAAAGATCCAAGACCATTCTTCAAGTTTGCAAAGGAAATATATCCTGGACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAGGAAGGAAAACTACTTCGCAACTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGAATCCAAAGGATAATTCAGTGTCATGGTTCCTTTGCAACAGCATCTTGCCTGATTTGTAAATACAAAGTTGACTGTGAAGCTGTACGAGGAGATATTTTTAATCAGGTAGTTCCTCGATGTCCTAGGTGCCCAGCTGATGAACCGCTTGCTATCATGAAACCAGAGATTGTGTTTTTTGGTGAAAATTTACCAGAACAGTTTCATAGAGCCATGAAGTATGACAAAGATGAAGTTGACCTCCTCATTGTTATTGGGTCTTCCCTCAAAGTAAGACCAGTAGCACTAATTCCAAGTTCCATACCCCATGAAGTGCCTCAGATATTAATTAATAGAGAACCTTTGCCTCATCTGCATTTTGATGTAGAGCTTCTTGGAGACTGTGATGTCATAATTAATGAATTGTGTCATAGGTTAGGTGGTGAATATGCCAAACTTTGCTGTAACCCTGTAAAGCTTTCAGAAATTACTGAAAAACCTCCACGAACACAAAAAGAATTGGCTTATTTGTCAGAGTTGCCACCCACACCTCTTCATGTTTCAGAAGACTCAAGTTCACCAGAAAGAACTTCACCACCAGATTCTTCAGTGATTGTCACACTTTTAGACCAAGCAGCTAAGAGTAATGATGATTTAGATGTGTCTGAATCAAAAGGTTGTATGGAAGAAAAACCACAGGAAGTACAAACTTCTAGGAATGTTGAAAGTATTGCTGAACAGATGGAAAATCCGGATTTGAAGAATGTTGGTTCTAGTACTGGGGAGAAAAATGAAAGAACTTCAGTGGCTGGAACAGTGAGAAAATGCTGGCCTAATAGAGTGGCAAAGGAGCAGATTAGTAGGCGGCTTGATGGTAATCAGTATCTGTTTTTGCCACCAAATCGTTACATTTTCCATGGCGCTGAGGTATATTCAGACTCTGAAGATGACGTCTTATCCTCTAGTTCTTGTGGCAGTAACAGTGATAGTGGGACATGCCAGAGTCCAAGTTTAGAAGAACCCATGGAGGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTAGAAGATGAGCCTGATGTTCCAGAGAGAGCTGGAGGAGCTGGATTTGGGACTGATGGAGATGATCAAGAGGCAATTAATGAAGCTATATCTGTGAAACAGGAAGTAACAGACATGAACTATCCATCAAACAAATCATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T14731-Ab Anti-SIRT1 monoclonal antibody
    Target Antigen GM-Tg-g-T14731-Ag SIRT1 protein
    ORF Viral Vector pGMLV000135 Human SIRT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000525 Human SIRT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000931 Human SIRT1 Lentivirus plasmid
    ORF Viral Vector pGMAD000463 Human SIRT1 Adenovirus plasmid
    ORF Viral Vector pGMAD000579 Human SIRT1 Adenovirus plasmid
    ORF Viral Vector pGMPC000017 Human SIRT1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000577 Human SIRT1 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-135 Human SIRT1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-275 Human SIRT1 Adenovirus plasmid
    ORF Viral Vector vGMLV000135 Human SIRT1 Lentivirus particle
    ORF Viral Vector vGMLV000525 Human SIRT1 Lentivirus particle
    ORF Viral Vector vGMLV000931 Human SIRT1 Lentivirus particle
    ORF Viral Vector vGMAD000463 Human SIRT1 Adenovirus particle
    ORF Viral Vector vGMAD000579 Human SIRT1 Adenovirus particle
    ORF Viral Vector vGMAP000577 Human SIRT1 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-135 Human SIRT1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-275 Human SIRT1 Adenovirus particle


    Target information

    Target ID GM-T14731
    Target Name SIRT1
    Gene ID 23411, 93759, 695682, 309757, 101087610, 489012, 613629, 100072571
    Gene Symbol and Synonyms SIR2,Sir2a,SIR2alpha,SIR2L1,SIRT1,sirtuin-1
    Uniprot Accession Q96EB6
    Uniprot Entry Name SIR1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000096717
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.