Human CXCL12/IRH/ PBSF ORF/cDNA clone-Adenovirus particle (NM_001178134.1)

Pre-made Human CXCL12/IRH/ PBSF Adenovirus for CXCL12 overexpression in-vitro and in-vivo. The CXCL12 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CXCL12-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CXCL12/IRH products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000581 Human CXCL12 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000581
Gene Name CXCL12
Accession Number NM_001178134.1
Gene ID 6387
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 423 bp
Gene Alias IRH, PBSF, SCYB12, SDF1, TLSF, TPAR1
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAACCTGATCAGCGCCGCACCAGCCGGGAAGAGGGTGATTGCTGGGGCTCGTGCCCTGCATCCCTCTCCTCCCAGGGCCTGCCCCACAGCTCGGGCCCTCTGTGAGATCCGTCTTTGGCCTCCTCCAGAATGGAGCTGGCCCTCTCCTGGGGATGTGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T04773-Ab Anti-SDF1/ CXCL12/ IRH functional antibody
    Target Antigen GM-Tg-g-T04773-Ag CXCL12 protein
    Cytokine cks-Tg-g-GM-T04773 chemokine (C-X-C motif) ligand 12 (CXCL12) protein & antibody
    ORF Viral Vector pGMLV000007 Human CXCL12 Lentivirus plasmid
    ORF Viral Vector pGMLV000955 Human CXCL12 Lentivirus plasmid
    ORF Viral Vector pGMAD000581 Human CXCL12 Adenovirus plasmid
    ORF Viral Vector pGMAAV000139 Human CXCL12 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000581 Human CXCL12 Adenovirus plasmid
    ORF Viral Vector vGMLV000007 Human CXCL12 Lentivirus particle
    ORF Viral Vector vGMLV000955 Human CXCL12 Lentivirus particle
    ORF Viral Vector vGMAD000581 Human CXCL12 Adenovirus particle
    ORF Viral Vector vGMAAV000139 Human CXCL12 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000581 Human CXCL12 Adenovirus particle
    ORF Viral Vector pGMLV002285 Human CXCL12 Lentivirus plasmid


    Target information

    Target ID GM-T04773
    Target Name CXCL12
    Gene ID 6387, 20315, 574334, 24772, 493806, 449622, 613811, 100049872
    Gene Symbol and Synonyms CXCL12,IRH,PBSF,SCYB12,SDF-1,SDF1,TLSF,TPAR1
    Uniprot Accession P48061
    Uniprot Entry Name SDF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000107562
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This antimicrobial gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. The encoded protein functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4, and plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.