Human CXCL12/IRH/ PBSF ORF/cDNA clone-Adenovirus plasmid (NM_199168)
Pre-made Human CXCL12/IRH/ PBSF adenoviral expression plasmid for CXCL12 adenovirus packaging, CXCL12 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CXCL12/IRH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000581 | Human CXCL12 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000581 |
Gene Name | CXCL12 |
Accession Number | NM_199168 |
Gene ID | 6387 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 270 bp |
Gene Alias | IRH, PBSF, SCYB12, SDF1, TLSF, TPAR1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T04773-Ab | Anti-SDF1/ CXCL12/ IRH functional antibody |
Target Antigen | GM-Tg-g-T04773-Ag | CXCL12 protein |
Cytokine | cks-Tg-g-GM-T04773 | chemokine (C-X-C motif) ligand 12 (CXCL12) protein & antibody |
ORF Viral Vector | pGMLV000007 | Human CXCL12 Lentivirus plasmid |
ORF Viral Vector | pGMLV000955 | Human CXCL12 Lentivirus plasmid |
ORF Viral Vector | pGMAD000581 | Human CXCL12 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000139 | Human CXCL12 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000581 | Human CXCL12 Adenovirus plasmid |
ORF Viral Vector | vGMLV000007 | Human CXCL12 Lentivirus particle |
ORF Viral Vector | vGMLV000955 | Human CXCL12 Lentivirus particle |
ORF Viral Vector | vGMAD000581 | Human CXCL12 Adenovirus particle |
ORF Viral Vector | vGMAAV000139 | Human CXCL12 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000581 | Human CXCL12 Adenovirus particle |
ORF Viral Vector | pGMLV002285 | Human CXCL12 Lentivirus plasmid |
Target information
Target ID | GM-T04773 |
Target Name | CXCL12 |
Gene ID | 6387, 20315, 574334, 24772, 493806, 449622, 613811, 100049872 |
Gene Symbol and Synonyms | CXCL12,IRH,PBSF,SCYB12,SDF-1,SDF1,TLSF,TPAR1 |
Uniprot Accession | P48061 |
Uniprot Entry Name | SDF1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000107562 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This antimicrobial gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. The encoded protein functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4, and plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.