Human NR1H4/BAR/FXR ORF/cDNA clone-Adenovirus particle (NM_001206993.2)

Cat. No.: vGMAD001310

Pre-made Human NR1H4/BAR/FXR Adenovirus for NR1H4 overexpression in-vitro and in-vivo. The NR1H4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NR1H4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to FXR/NR1H4/BAR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001310 Human NR1H4 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001310
Gene Name NR1H4
Accession Number NM_001206993.2
Gene ID 9971
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1461 bp
Gene Alias BAR,FXR,HRR-1,HRR1,PFIC5,RIP14
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGTAATGCAGTTTCAGGGGTTAGAAAATCCAATTCAAATTAGTCCTCACTGCAGCTGTACGCCGTCAGGATTTTTCATGGAAATGATGAGTATGAAGCCCGCGAAAGGTGTTTTAACAGAACAAGTGGCAGGTCCTCTGGGACAGAACCTGGAAGTGGAACCATACTCGCAATACAGCAATGTTCAGTTTCCCCAAGTTCAACCACAGATTTCCTCGTCATCCTATTATTCCAACCTGGGTTTCTACCCCCAGCAGCCTGAAGAGTGGTACTCTCCTGGAATATATGAACTCAGGCGTATGCCAGCTGAGACTCTCTACCAGGGAGAAACTGAGGTAGCAGAGATGCCTGTAACAAAGAAGCCCCGCATGGGCGCGTCAGCAGGGAGGATCAAAGGGGATGAGCTGTGTGTTGTTTGTGGAGACAGAGCCTCTGGATACCACTATAATGCACTGACCTGTGAGGGGTGTAAAGGTTTCTTCAGGAGAAGCATTACCAAAAACGCTGTGTACAAGTGTAAAAACGGGGGCAACTGTGTGATGGATATGTACATGCGAAGAAAGTGTCAAGAGTGTCGACTAAGGAAATGCAAAGAGATGGGAATGTTGGCTGAATGTATGTATACAGGCTTGTTAACTGAAATTCAGTGTAAATCTAAGCGACTGAGAAAAAATGTGAAGCAGCATGCAGATCAGACCGTGAATGAAGACAGTGAAGGTCGTGACTTGCGACAAGTGACCTCGACAACAAAGTCATGCAGGGAGAAAACTGAACTCACCCCAGATCAACAGACTCTTCTACATTTTATTATGGATTCATATAACAAACAGAGGATGCCTCAGGAAATAACAAATAAAATTTTAAAAGAAGAATTCAGTGCAGAAGAAAATTTTCTCATTTTGACGGAAATGGCAACCAATCATGTACAGGTTCTTGTAGAATTCACAAAAAAGCTACCAGGATTTCAGACTTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCTGAGATGCTGATGTCATGGAGAGTAAACGACCACAAGTTTACCCCACTTCTCTGTGAAATCTGGGACGTGCAGTGA
ORF Protein Sequence MVMQFQGLENPIQISPHCSCTPSGFFMEMMSMKPAKGVLTEQVAGPLGQNLEVEPYSQYSNVQFPQVQPQISSSSYYSNLGFYPQQPEEWYSPGIYELRRMPAETLYQGETEVAEMPVTKKPRMGASAGRIKGDELCVVCGDRASGYHYNALTCEGCKGFFRRSITKNAVYKCKNGGNCVMDMYMRRKCQECRLRKCKEMGMLAECMYTGLLTEIQCKSKRLRKNVKQHADQTVNEDSEGRDLRQVTSTTKSCREKTELTPDQQTLLHFIMDSYNKQRMPQEITNKILKEEFSAEENFLILTEMATNHVQVLVEFTKKLPGFQTLDHEDQIALLKGSAVEAMFLRSAEIFNKKLPSGHSDLLEERIRNSGISDEYITPMFSFYKSIGELKMTQEEYALLTAIVILSPDRQYIKDREAVEKLQEPLLDVLQKLCKIHQPENPQHFACLLGRLTELRTFNHHHAEMLMSWRVNDHKFTPLLCEIWDVQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51426-Ab Anti-FXR monoclonal antibody
    Target Antigen GM-Tg-g-T51426-Ag FXR/NR1H4 protein
    ORF Viral Vector pGMLV001593 Human NR1H4 Lentivirus plasmid
    ORF Viral Vector pGMLV001799 Human NR1H4 Lentivirus plasmid
    ORF Viral Vector pGMLV002038 Human NR1H4 Lentivirus plasmid
    ORF Viral Vector pGMLV002444 Human NR1H4 Lentivirus plasmid
    ORF Viral Vector pGMAD001310 Human NR1H4 Adenovirus plasmid
    ORF Viral Vector vGMLV001593 Human NR1H4 Lentivirus particle
    ORF Viral Vector vGMLV001799 Human NR1H4 Lentivirus particle
    ORF Viral Vector vGMLV002038 Human NR1H4 Lentivirus particle
    ORF Viral Vector vGMLV002444 Human NR1H4 Lentivirus particle
    ORF Viral Vector vGMAD001310 Human NR1H4 Adenovirus particle


    Target information

    Target ID GM-T51426
    Target Name FXR
    Gene ID 9971, 20186, 695618, 60351, 101096997, 612928, 540528, 100052821
    Gene Symbol and Synonyms BAR,FXR,HRR-1,HRR1,NR1H4,PFIC5,RIP14,Rxrip14
    Uniprot Accession Q96RI1
    Uniprot Entry Name NR1H4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000012504
    Target Classification Nuclear Receptors

    This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.