Human SVBP ORF/cDNA clone-Adenovirus particle (BC029427)

Pre-made Human SVBP/ Adenovirus for SVBP overexpression in-vitro and in-vivo. The SVBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SVBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to SVBP/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000413 Human SVBP Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000413
Gene Name SVBP
Accession Number BC029427
Gene ID 374969
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 201 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCCACCTGCACGTAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAGAAGGCCAAACAGAAATCAGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAGATCTATGCCCTCAACAGAGTCATGACAGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAGATGCAGCCTCCTGGAGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1327-Ab Anti-SVBP/ CCDC23 functional antibody
    Target Antigen GM-Tg-g-SE1327-Ag SVBP protein
    ORF Viral Vector pGMAP000413 Human SVBP Adenovirus plasmid
    ORF Viral Vector pGMAP000517 Human SVBP Adenovirus plasmid
    ORF Viral Vector vGMAP000413 Human SVBP Adenovirus particle
    ORF Viral Vector vGMAP000517 Human SVBP Adenovirus particle


    Target information

    Target ID GM-SE1327
    Target Name SVBP
    Gene ID 374969, 69216, 698308, 362578, 101094775, 100683368, 614073, 100053543
    Gene Symbol and Synonyms 2410005K17Rik,CCDC23,NEDAHM,RGD1311232,SVBP
    Uniprot Accession Q8N300
    Uniprot Entry Name SVBP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000177868
    Target Classification Not Available

    Enables microtubule binding activity. Involved in axon development; proteolysis; and regulation of metallopeptidase activity. Acts upstream of or within negative regulation of endothelial cell migration; negative regulation of protein ubiquitination; and protein secretion. Located in apical part of cell. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.