- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human SVBP ORF/cDNA clone-Adenovirus plasmid (BC029427)
Pre-made Human SVBP/ adenoviral expression plasmid for SVBP adenovirus packaging, SVBP adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to SVBP/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMAP000413 | Human SVBP Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMAP000413 |
| Gene Name | SVBP |
| Accession Number | BC029427 |
| Gene ID | 374969 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 201 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGATCCACCTGCACGTAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAGAAGGCCAAACAGAAATCAGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAGATCTATGCCCTCAACAGAGTCATGACAGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAGATGCAGCCTCCTGGAGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1327-Ab | Anti-SVBP/ CCDC23 functional antibody |
| Target Antigen | GM-Tg-g-SE1327-Ag | SVBP protein |
| ORF Viral Vector | pGMAP000413 | Human SVBP Adenovirus plasmid |
| ORF Viral Vector | pGMAP000517 | Human SVBP Adenovirus plasmid |
| ORF Viral Vector | vGMAP000413 | Human SVBP Adenovirus particle |
| ORF Viral Vector | vGMAP000517 | Human SVBP Adenovirus particle |
Target information
| Target ID | GM-SE1327 |
| Target Name | SVBP |
| Gene ID | 374969, 69216, 698308, 362578, 101094775, 100683368, 614073, 100053543 |
| Gene Symbol and Synonyms | 2410005K17Rik,CCDC23,NEDAHM,RGD1311232,SVBP |
| Uniprot Accession | Q8N300 |
| Uniprot Entry Name | SVBP_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000177868 |
| Target Classification | Not Available |
Enables microtubule binding activity. Involved in axon development; proteolysis; and regulation of metallopeptidase activity. Acts upstream of or within negative regulation of endothelial cell migration; negative regulation of protein ubiquitination; and protein secretion. Located in apical part of cell. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
